RNALogo - a new approach to display structural RNA alignment
Home CreateLogo Gallery Documentation Help

► The RNALogo of RF00037 family:
 

Note : You need the Adobe SVG plugin or an SVG enabled browser to view the graphics (Download)
           (For obtaining the complete functions and best resolution of SVG, we strongly recommand using the Internet Explore for browsing.)
See detail values
See the detail description of RF00037 in Rfam
 

► The SequenceLogo of RF00037 family:

► Reset display of RNALogo of RF00037 family:
 Family sequences selection : Seed ( 39 seqs.) Full ( 318 seqs.)
 Output image format :  
 Output image size :   x pixel

 


► The sequences in RF00037 family:
# STOCKHOLM 1.0

#=GF AC   RF00037
#=GF ID   IRE
#=GF DE   Iron response element
#=GF AU   Griffiths-Jones SR
#=GF SE   Griffiths-Jones SR
#=GF SS   Published; PMID:8710843
#=GF GA   17.50
#=GF TC   17.54
#=GF NC   17.48
#=GF TP   Cis-reg;
#=GF BM   cmbuild CM SEED
#=GF BM   cmsearch -W 40 CM SEQDB
#=GF RN   [1]
#=GF RM   8710843
#=GF RT   Molecular control of vertebrate iron metabolism: mRNA-based
#=GF RT   regulatory circuits operated by iron, nitric oxide, and oxidative
#=GF RT   stress.
#=GF RA   Hentze MW, Kuhn LC;
#=GF RL   Proc Natl Acad Sci U S A 1996;93:8175-8182.
#=GF CC   The iron response element is a short conserved stem-loop which is
#=GF CC   bound by iron response proteins (IRPs).  The IRE is found in UTRs
#=GF CC   of various mRNAs whose products are involved in iron metabolism.
#=GF CC   For example, the mRNA of ferritin (an iron storage protein)
#=GF CC   contains one IRE in its 5' UTR.  When iron concentration is low,
#=GF CC   IRPs bind the ferritin mRNA IRE leading to translation
#=GF CC   repression.  Binding of multiple IREs in the 3' and 5' UTRs of
#=GF CC   the transferrin receptor (involved in iron acquisition) leads to
#=GF CC   increased mRNA stability.  These two activities form the basis of
#=GF CC   iron homeostasis in the vertebrate cell.
#=GF SQ   39

AY120878.1/50-76                     GGUCGC..GUCAACAGUGUUUGAU.CGAAC
AF266195.1/14-43                     AUUCUUGCUUCAACAGUGUUUGAACGGAAU
D86625.1/6-35                        GUUCUUGUUUCAACAGUGAUUGAACGGAAC
AF338763.1/11-40                     UUACCUGCUUCAACAGUGCUUGAACGGCAA
S77386.1/28-57                       GUUCUUGCUUCAACAGUGAUUGAACGGAAC
J02723.1/161-190                     GUUCUUGCUUCAACAGUAUUUGAACGGAAC
M12120.1/24-53                       GUUCUUGCUUCAACAGUGUUUGAACGGAAC
X13753.1/1434-1460                   UAUAUC..GGAGGCAGUGACCUCC.AUAUG
X13753.1/1481-1507                   AUUAUC..GGGGACAGUGUUUCCC.AUAAU
X13753.1/830-856                     UUUAUC..AGUGACAGCGUUCACU.AUAAA
M16343.1/1306-1335                   GUUCCUGCGUCAACAGUGCUUGGACGGAAC
X13753.1/1371-1397                   AUUAUC..GGGGGCAGUGUCUUCC.AUAAU
AB073371.1/5-34                      UCUCCUGCUUCAACAGUGCUUGGACGGAGC
AF171078.1/1416-1442                 UGGUUC..GUCCUCAGUGCAGGGC.AACAG
L39879.1/1190-1219                   GUACUUGCUUCAACAGUGUUUGAACGGAAC
AJ426432.1/1593-1619                 AUUAUC..GGGAGCAGUGUCUUCC.AUAAU
BC019840.1/11-40                     UGUCUUGCUUCAACAGUGUUUGAACGGAAC
AJ426432.1/1658-1684                 UAUAUC..GGAGACAGUGAUCUCC.AUAUG
M58040.1/3309-3335                   UAUAUC..GGAGACAGUGACCUCC.AUAUG
J02741.1/400-429                     UAUCUUGCUUCAACAGUGUUUGGACGGAAC
AC073115.5/47515-47486               UCUCUUGCUUCAACAGUGUUUGGAUGGAAC
AL355837.6/87643-87614               GUUCCUGCUUCAACAGUGUUUGGAUGGAAC
BC001188.1/3791-3817                 AUUAUC..GGGAACAGUGUUUCCC.AUAAU
AL034379.8/68035-68064               UUUCCUGGUUCAACAGUGCUUGGACGGAAC
AL513423.3/108544-108573             UUUCCUGCUUCAACAGUGCUUGGAUGGAAC
J04755.1/950-979                     UUUCCUGCUUCAGCAGUGCUUGGACGGAAC
AF117958.1/132-161                   UCUCUUGUUUCAACAGUGUUUGGACGGAAC
AB062402.1/11-40                     UUUCCUGCUUCAACAGUGCUUGGACGGAAC
AC109352.3/19020-19048               UUUCCUGUUUCAACAGUGCUUGGA.GGAAC
AP003174.2/91762-91734               UUUCUUC.UUCAACAGUGUUUGGAUGGAAC
S57280.1/391-417                     UCGUUC..GUCCUCAGUGCAGGGC.AAUAG
X03744.1/2-29                        UCUUGC..UUCAACAGUGUUUGGACGGAAG
X01060.1/3950-3976                   UGUAUC..GGAGACAGUGAUCUCC.AUAUG
X01060.1/3482-3508                   AUUAUC..GGAAGCAGUGCCUUCC.AUAAU
X01060.1/3432-3458                   UUUAUC..AGUGACAGAGUUCACU.AUAAA
BC016354.1/30-59                     UCUCUUGCUUCAACAGUGUUUGGACGGAAC
AF285177.1/3-32                      GUUCCUGCUUCAACAGUGCUUGGACGGAAC
AF086786.1/2-28                      UCGUUC..GUCCUCAGUGCAGGGC.AACAG
AY112742.1/12-41                     AGUCCUGCUUCAACAGUGCUUGAACGGAAC
#=GC SS_cons                         <<<<<...<<<<<......>>>>>.>>>>>
//

Department of Computer Science and Information Engineering, National Central University, Tao-yuan, Taiwan
Contact with site administrator:
Tzu-Hao Chang