RNALogo - a new approach to display structural RNA alignment
Home CreateLogo Gallery Documentation Help

► The RNALogo of RF00050 family:
 


See detail values
See the detail description of RF00050 in Rfam
 

► The SequenceLogo of RF00050 family:

► Reset display of RNALogo of RF00050 family:
 Family sequences selection : Seed ( 34 seqs.) Full ( 183 seqs.)
 Output image format :  
 Output image size :   x pixel

 


► The sequences in RF00050 family:
# STOCKHOLM 1.0

#=GF AC   RF00050
#=GF ID   FMN
#=GF DE   FMN riboswitch (RFN element)
#=GF PI   RFN;
#=GF AU   Vitreshchak A, Gelfand M, Bateman A
#=GF SE   Vitreshchak A
#=GF SS   Published; PMID:12456892
#=GF GA   18.50
#=GF TC   18.84
#=GF NC   17.98
#=GF TP   Cis-reg; riboswitch;
#=GF BM   cmbuild CM SEED
#=GF BM   cmsearch -W 250 CM SEQDB
#=GF RN   [1]
#=GF RM   12136096
#=GF RT   Regulation of riboflavin biosynthesis and transport genes in bacteria
#=GF RT   by transcriptional and translational attenuation.
#=GF RA   Vitreschak AG, Rodionov DA, Mironov AA, Gelfand MS;
#=GF RL   Nucleic Acids Res 2002;30:3141-3151.
#=GF RN   [2]
#=GF RM   10529804
#=GF RT   A conserved RNA structure element involved in the regulation of
#=GF RT   bacterial riboflavin synthesis genes.
#=GF RA   Gelfand MS, Mironov AA, Jomantas J, Kozlov YI, Perumov DA;
#=GF RL   Trends Genet 1999;15:439-442.
#=GF RN   [3]
#=GF RM   12456892
#=GF RT   An mRNA structure that controls gene expression by binding FMN.
#=GF RA   Winkler WC, Cohen-Chalamish S, Breaker RR;
#=GF RL   Proc Natl Acad Sci U S A 2002;99:15908-15913.
#=GF CC   The RFN element is a highly conserved domain that is found
#=GF CC   frequently in the 5'-untranslated regions of prokaryotic mRNAs
#=GF CC   that encode for flavin mononucleotide (FMN) biosynthesis and
#=GF CC   transport proteins. This element is a metabolite-dependent
#=GF CC   riboswitch that directly binds FMN in the absence of proteins. In
#=GF CC   Bacillus subtilis, the riboswitch most likely controls gene
#=GF CC   expression by causing premature transcription termination within
#=GF CC   the 5' untranslated region of the ribDEAHT operon and precluding
#=GF CC   access to the ribosome-binding site of ypaA mRNA [3].
#=GF SQ   34

AL939108.1/337004-336876             CAGCGCACUCCGGGGUCGGUGAAAGUCCGAACCGGCGGUUA.........
AE001878.1/30-178                    GACCUCUUUCGGGGCGGGGCGAAAUUCCCCACCGGCGGUAAGUUCUCCCG
Z99116.2/921-787                     AUCAAUCUUCGGGGCAGGGUGAAAUUCCCUACCGGCGGUGAUGAGCCAAU
L09228.1/7992-8136                   UUGUAUCUUCGGGGCAGGGUGGAAAUCCCGACCGGCGGUAGUAAAGCACA
X95955.1/376-523                     UGUAUCCUUCGGGGCUGGGUGAAAAUCCCGACCGGCGGUAAUAAGGCGCU
X51510.1/938-1082                    UGUAUCCUUCGGGGCAGGGUGGAAAUCCCGACCGGCGGUAGUAAAGCACA
AJ010128.1/362-218                   CAGCAUCUUCGGGGUCGGGUGAAAUUCCCAACCGGCGGUGAUGAAGUGCA
AL591981.1/267609-267487             GUUCAUCUUCGGGGCAGGGUGCAAUUCCCGACCGGUGGUUA.........
AL596170.1/284996-284874             GUUCAUCUUCGGGGCAGGGUGCAAUUCCCGACCGGUGGUUA.........
AF269712.1/1300-1435                 AUUCAUCUUCGGGGUAGGGUGUAAUUCCCAACCGGCAGUAAUCU......
AF269345.1/3001-2863                 UAUUUCUUUCGGGGCAGGGUGAAAUUCCCAACCGGCAGUAAAUU......
AE007781.1/7704-7588                 AAUGAUCUUCAGGGCAGGGUGAAAUUCCCUACCGGCGGUA..........
AE007574.1/3571-3685                 GAUGUUCUUCAGGGAUGGGUGAAAUUCCCAAUCGGCGGUA..........
AE013024.1/1-102                     .........CGGGGCAGGGUGGAAUUCCCGACCGGCAGUGA.........
AE006333.1/7352-7468                 AUAAAUCUUCAGGGCAGGGUGUAAUUCCCUACCGGCGGUA..........
AE006360.1/976-840                   AAAUAUCUUCAGGGCACCGUGUAAUUCGGGACCGGCGGUAAAUAGGGCUU
AE014142.1/1906-2030                 AAGUGUCUUCAGGGCAGGGUGUGAUUCCCGACCGGCGGUGACUAGGUAAC
AL766851.1/11027-10882               AGGUGUCUUCAGGGCAGGGUGUAAUUCCCGACCGGCGGUAAUCGCUUCCA
AE007333.1/6190-6076                 AACUAUCUUCAGGGCAGGGUGAAAUUCCCUACCGGUGGUA..........
AL766847.1/1-103                     ......CUUCGGGGUCAGGUGAAAAUCCUAACCGGCGGUA..........
AE008399.1/8878-8764                 AACUAUCUUCAGGGCAGGGUGCAAUUCCCUACCGGUGGUA..........
AE009695.1/6814-6651                 GCUUGUUCUCGGGGCGGGGUGAAACUCCCCACCGGCGGUAUGAAAAGCAA
AE008109.1/1004-1154                 GGUUGUUCUCAGGGCGGGGUGCAAUUCCCCACCGGCGGUAUCGGGAUUUG
AL591790.1/15823-15987               AAGCGUUCUCAGGGCGGGGUGAAAUUCCCCACCGGCGGUAGCGAACACAG
AL646083.1/100911-100755             GUACGUCUUCAGGGCGGGGUGGAAUUCCCCACCGGCGGUAUGCGGGCCAU
M64472.1/901-1048                    GCUUAUUCUCAGGGCGGGGCGAAAUUCCCCACCGGCGGUAAAUCAACUCA
U27202.1/210-335                     AAUAAUCUUCAGGGCAGGGUGAAAUUCCCGAUCGGCGGUA..........
U32760.1/7642-7819                   UCGCAUUCUCAGGGCAGGGUGAAAUUCCCUACCGGUGGUA..........
AE006176.1/9504-9349                 GCGCAUUCUCAGGGCAGGGUGAAAUUCCCUACCGGUGGUAAAUGUAUAAC
AE004822.1/2219-2057                 UAACGUUCUCAGGGCGGGGUGAAAGUCCCCACCGGCGGUAAUGGCGCGCA
AE004431.1/9358-9220                 CAAUAUUCUCAGGGCGGGGCGAAAUUCCCCACCGGUGGUAUGCCGCAAGG
AE012168.1/3092-3260                 GAACGUCUUCAGGGCGGGGUGCGAUUCCCCACCGGCGGUAUGCAUGCGCA
AJ009832.1/4549-4670                 GAUCGCUCUCGGGGCAGGGUGGAAUUCCCGACCGGCGGUGA.........
AE001820.1/156-35                    AAACGCUCUCGGGGCAGGGUGGAAUUCCCGACCGGCGGUGA.........
#=GC SS_cons                         <<<<<<<<<<......<<<.......>>>.....<<<<............

AL939108.1/337004-336876             ........................CAGUCCGCGA.CCCGGUCGCC.....
AE001878.1/30-178                    AAC.....................AAGCCCGCGAAGCCCGCGCAAAC...
Z99116.2/921-787                     GGCUCU..................AAGCCCGCGA.GC.............
L09228.1/7992-8136                   UUUGCUUUA...............GAGCCCGUGA.CCCGUGUGC......
X95955.1/376-523                     CCUGCGCUUUA.............CAGCCCGUGA.CCCGUAUGC......
X51510.1/938-1082                    UUUGCUUUA...............GAGCCCGUGA.CCCGUGUGC......
AJ010128.1/362-218                   AACUUCU.................AAGUCCGUGA.CCCGUUUUCA.....
AL591981.1/267609-267487             ........................AAGUCCACGA.UCUGC..........
AL596170.1/284996-284874             ........................AAGUCCACGA.UCUGC..........
AF269712.1/1300-1435                 ........................AAGCCUGCGA..CGACAACGUAUUAA
AF269345.1/3001-2863                 ........................GAGCCUGCGA.CCCACUAAUAUUGUU
AE007781.1/7704-7588                 ........................UAGCCCGCGA.GC.............
AE007574.1/3571-3685                 ........................AAGCCCGCAA.GCC............
AE013024.1/1-102                     ........................AAGCCUGCGA.GCC............
AE006333.1/7352-7468                 ........................UAGCCCGCGA.GC.............
AE006360.1/976-840                   UGACCUUAU...............GACUCCGCGAUUCGCUAC........
AE014142.1/1906-2030                 UAG.....................AAGUCCGCGA.GC.............
AL766851.1/11027-10882               ACUUAUUUGUCAGUUGUGAAGCAUCAGUCCGCGA.GC.............
AE007333.1/6190-6076                 ........................UAGCCCACGA.GC.............
AL766847.1/1-103                     ........................UAGUCCGCGA.GC.............
AE008399.1/8878-8764                 ........................UAGCCCACGA.GC.............
AE009695.1/6814-6651                 UUUUC...................AAGCCCGCGA.GCGCCUGAAAUGGAA
AE008109.1/1004-1154                 UCCCG...................GAGCCCGCGA.GCGCUUCCGGUCUCC
AL591790.1/15823-15987               GAUCGGGAAUGGUCGGUGGUCG..GAGCCCGCGA.GCGCUUCGCAUUUCG
AL646083.1/100911-100755             CGGUCUGC................GAGCCCGCGA.GCGCCCGGCAUGCGC
M64472.1/901-1048                    GUUGA...................AAG.CCGCGA.GCGCUUUGGGUGCGA
U27202.1/210-335                     ........................AAGUCCGCGA.GCCGAACGA......
U32760.1/7642-7819                   ........................AAGCCCACGA.GCGUUUAAAAGUGCG
AE006176.1/9504-9349                 AU......................AAGCCCACGA.GCGUUUACUAUUUCA
AE004822.1/2219-2057                 AGGCGCC.................UAGCCCGCGA.GCGCUUGCCGGACCG
AE004431.1/9358-9220                 C.......................GAGCCCACGA.GCGCUCGAUU.....
AE012168.1/3092-3260                 AGCGUGU.................GAGCCCGCGA.GCGCUUCGCUGCCGA
AJ009832.1/4549-4670                 ........................AAGCCCGCGA.GCC............
AE001820.1/156-35                    ........................AAGCCCGCGA.GCC............
#=GC SS_cons                         ...........................>>>>...................

AL939108.1/337004-336876             ..............................................UCCA
AE001878.1/30-178                    ..............................................CGCA
Z99116.2/921-787                     ..............................................UGUC
L09228.1/7992-8136                   ..............................................AUAA
X95955.1/376-523                     ..............................................AUCU
X51510.1/938-1082                    ..............................................AUAA
AJ010128.1/362-218                   ..............................................ACUC
AL591981.1/267609-267487             ..............................................UUUU
AL596170.1/284996-284874             ..............................................UUUC
AF269712.1/1300-1435                 U.............................................UUUU
AF269345.1/3001-2863                 UU............................................UGAU
AE007781.1/7704-7588                 ................................................CU
AE007574.1/3571-3685                 ..................................................
AE013024.1/1-102                     ................................................GC
AE006333.1/7352-7468                 ................................................UG
AE006360.1/976-840                   ..................................................
AE014142.1/1906-2030                 ..................................................
AL766851.1/11027-10882               ..................................................
AE007333.1/6190-6076                 ..................................................
AL766847.1/1-103                     ..................................................
AE008399.1/8878-8764                 ..................................................
AE009695.1/6814-6651                 GCCGAUUCGCAUGCCA..............................UUUC
AE008109.1/1004-1154                 AAAG..........................................CCGG
AL591790.1/15823-15987               ..............................................UGCG
AL646083.1/100911-100755             AGCGCA........................................UGCC
M64472.1/901-1048                    A.............................................CUCA
U27202.1/210-335                     ..............................................AAAA
U32760.1/7642-7819                   GUCAAUUUUUGGCAAAUUUUUCCUGCGAAAUUGUCCUGAUUUUCACUUUU
AE006176.1/9504-9349                 UGUCACAAGAGA..................................UAGU
AE004822.1/2219-2057                 GCCACCGCCGGA..................................CGAC
AE004431.1/9358-9220                 ..............................................CGUC
AE012168.1/3092-3260                 UCUCUCGCUGAGAGCACGGC..........................GGUG
AJ009832.1/4549-4670                 ..............................................CCCU
AE001820.1/156-35                    ..............................................CUCU
#=GC SS_cons                         ..................................................

AL939108.1/337004-336876             GCGACCGGUUGACCAG.....GUGAAAUUCCUGGACCGACGGUUAAAGUC
AE001878.1/30-178                    CCACGCGCCGGGCCCGAUGCCGCGCAACUCGGCAGCCGACGGUCACAGUC
Z99116.2/921-787                     UUUACAGCAGGAUUCG.....GUGAGAUUCCGGAGCCGACAG.UACAGUC
L09228.1/7992-8136                   GCACGCGGUGGAUUCA.....GUUUAA.GCUGAAGCCGACAGUGAAAGUC
X95955.1/376-523                     GUAUACGGUGGAUUCA.....GUGAAAAGCUGAAGCCGACAGUGAAAGUC
X51510.1/938-1082                    GCACGCGGUGGAUUCA.....GUUUAA.GCUGAAGCCGACAGUGAAAGUC
AJ010128.1/362-218                   GAAAACGGUGGAUCUA.....GUGAAACUCUAGGGCCGACAG.UAUAGUC
AL591981.1/267609-267487             UUAGCAGUUGACUCUG.....GUGUAAUUCCAGGACCGACAG.UAUAGUC
AL596170.1/284996-284874             UUAGCAGUUGACUCUG.....GUGUAAUUCCAGGACCGACAG.UAUAGUC
AF269712.1/1300-1435                 GCUUUGUCUUGAUUCA.....GUGAGAGUCUGAAGCCGACAG.UAUAGUC
AF269345.1/3001-2863                 GUUAGUGGCUGAUCUA.....GUGUGAAUCUAGAGCCGACAGUUAGAGUC
AE007781.1/7704-7588                 UUUUAGGUAUGAUCCG.....GUUUGAUUCCGGAGCCGACAG.UAAAGUC
AE007574.1/3571-3685                 ..AUUUGGCAGAUCCG.....GUUAAACUCCGGGGCCGACAGUUAAAGUC
AE013024.1/1-102                     AUAUGCGGUUGACUCG.....GUGAAAUUCCGAGGCCGACGGUAAAAGUC
AE006333.1/7352-7468                 CUUGCAGCAUGAUUCG.....GUGAAACUCCGAGGCCGACAG.UAUAGUC
AE006360.1/976-840                   ...GGCGAUUGAAGCA.....GUGAGAAUCUGCUAGCGACAG.UAAAGUC
AE014142.1/1906-2030                 ...GCAAGCUGAUGUG.....GUGUAACUCCACAACCGACAG.UAUAGUC
AL766851.1/11027-10882               ...GAAAGCUGAUGUG.....GUGAGAUUCCACAACCGACAG.UAAAGUC
AE007333.1/6190-6076                 CGAAAGGCAUGAUUUG.....GUGAAAUUCCAAAGCCGACAG.UAUAGUC
AL766847.1/1-103                     UUUCGAGCAUGAACUG.....GUGUGAUUCCAGUACCGACAG.UAAAGUC
AE008399.1/8878-8764                 CGAAAGGCAUGAUUUG.....GUGAAAUUCCAAAGCCGACAG.UAUAGUC
AE009695.1/6814-6651                 AGGGUCAGCAGAUCCG.....GUGAGAUGCCGGAGCCGACGGUUAAAGUC
AE008109.1/1004-1154                 AAGGUCAGCAGAUCCG.....GUGAGAGGCCGGAGCCGACGG.UAUAGUC
AL591790.1/15823-15987               AAGGUCAGCAGAUCCG.....GUCGAAUUCCGGAGCCGACGGUUAUAGUC
AL646083.1/100911-100755             GGGGUCAGCAGAUCCG.....GUGAGAUGCCGGGGCCGACGGUCAGAGUC
M64472.1/901-1048                    AAGGACAGCAGAUCCG.....GUGUAAUUCCGGGGCCGACGGUUAGAGUC
U27202.1/210-335                     GGUUUGGCAGGAACCG.....GUGAGAUUCCGGUACCGACAG.UAUAGUC
U32760.1/7642-7819                   AAAGUCAGCAGAUUUG.....GUGAAAUUCCAAAGCCGACAG.UAAAGUC
AE006176.1/9504-9349                 AAAGUCAGCAGAUUUG.....GUGAGAAUCCAAAGCCGACAG.UAUAGUC
AE004822.1/2219-2057                 AAGGUCAGCAGACCCG.....GUGCGAUUCCGGGGCCGACGGUCAUAGUC
AE004431.1/9358-9220                 GAGGUCAGCAGAUCUG.....GUGAGAAGCCAGGGCCGACGGUUACAGUC
AE012168.1/3092-3260                 AAGGUCAGCAGAUCCG.....GUGCGAUGCCGGGGCCGACGG.UAUAGUC
AJ009832.1/4549-4670                 UCUGGGGGUUGACCCG.....GUGGAAUUCCGGGGCCGACGGUGAAAGUC
AE001820.1/156-35                    CAGGAGGGUUGACCCG.....GUGGAAUUCCGGGGCCGACGGUGAAAGUC
#=GC SS_cons                         ............<<<<.....<.......>>>>>.....<<<.......>

AL939108.1/337004-336876             CGGAUGGG.AGGCAGUGCGC.
AE001878.1/30-178                    CGGACGAA.AGAAGGAGGAG.
Z99116.2/921-787                     UGGAUGGG.AGAAGAUGGAG.
L09228.1/7992-8136                   UGGAUGGG.AGAAGGAUGAU.
X95955.1/376-523                     UGGAUGGG.AGAAGGAUGAG.
X51510.1/938-1082                    UGGAUGGG.AGAAGGAUGAU.
AJ010128.1/362-218                   UGGAUGGG.AGAAGGAUAUGU
AL591981.1/267609-267487             UGGAUGGG.AGAAGAUGUUG.
AL596170.1/284996-284874             UGGAUGGG.AGAAGAUGUUG.
AF269712.1/1300-1435                 UGGAUGGG.AGAAGAUGGAG.
AF269345.1/3001-2863                 UGGAUGGG.AGAAAGAAGUU.
AE007781.1/7704-7588                 UGGAUGAA.AGAAGAUAUAU.
AE007574.1/3571-3685                 UGGAUGAA.AGAAGAAAUAG.
AE013024.1/1-102                     CGGAUGGG.AG..........
AE006333.1/7352-7468                 UGGAUGAA.AGAAGAUAAUA.
AE006360.1/976-840                   UGGAUGGA.AGAAGAUGAAC.
AE014142.1/1906-2030                 UGGAUGAG.AGAAGACCGGG.
AL766851.1/11027-10882               UGGAUGGG.AGAAGACAAAG.
AE007333.1/6190-6076                 UGGAUGAA.AGAAGAUAAAA.
AL766847.1/1-103                     UGGAUGAG.AGAAG.......
AE008399.1/8878-8764                 UGGAUGAA.AGAAGAUAAAA.
AE009695.1/6814-6651                 CGGAUGGA.AGAGAGCGAAU.
AE008109.1/1004-1154                 CGGAUGGA.AGAGGACAAGG.
AL591790.1/15823-15987               CGGAUGGA.AGAGAGCAAGC.
AL646083.1/100911-100755             CGGAUGGA.AGAAGAUGUGC.
M64472.1/901-1048                    CGGAUGGG.AGAGAGUAACG.
U27202.1/210-335                     UGGAUGGA.AGAAGAUGAAA.
U32760.1/7642-7819                   UGGAUGAA.AGAGAAUAAAA.
AE006176.1/9504-9349                 UGGAUGAA.AGAGAAUAAGC.
AE004822.1/2219-2057                 CGGAUAAAGAGAGAACGGGA.
AE004431.1/9358-9220                 CGGAUGAG.AGAGAAUGACA.
AE012168.1/3092-3260                 CGGAUGAA.AGAAGACGGCC.
AJ009832.1/4549-4670                 CGGAUGGG.AGAGAGCGAAG.
AE001820.1/156-35                    CGGAUGGG.AGAGAGCGUGA.
#=GC SS_cons                         >>........>>>>>>>>>>.
//

Department of Computer Science and Information Engineering, National Central University, Tao-yuan, Taiwan
Contact with site administrator:
Tzu-Hao Chang