RNALogo - a new approach to display structural RNA alignment
Home CreateLogo Gallery Documentation Help

► The RNALogo of RF00059 family:
 


See detail values
See the detail description of RF00059 in Rfam
 

► The SequenceLogo of RF00059 family:

► Reset display of RNALogo of RF00059 family:
 Family sequences selection : Seed ( 174 seqs.) Full ( 496 seqs.)
 Output image format :  
 Output image size :   x pixel

 


► The sequences in RF00059 family:
# STOCKHOLM 1.0

#=GF AC   RF00059
#=GF ID   TPP
#=GF DE   TPP riboswitch (THI element)
#=GF PI   THI;
#=GF AU   Vitreshchak A, Gelfand M, Bateman A, Moxon SJ
#=GF SE   Vitreshchak A
#=GF SS   Published; PMID:12376536; Moxon SJ
#=GF GA   27.20
#=GF TC   27.26
#=GF NC   27.16
#=GF TP   Cis-reg; riboswitch;
#=GF BM   cmbuild CM SEED
#=GF BM   cmsearch -W 300 CM SEQDB
#=GF RN   [1]
#=GF RM   12376536
#=GF RT   Comparative genomics of thiamin biosynthesis in procaryotes. New
#=GF RT   genes and regulatory mechanisms.
#=GF RA   Rodionov DA, Vitreschak AG, Mironov AA, Gelfand MS;
#=GF RL   J Biol Chem 2002;277:48949-48959.
#=GF RN   [2]
#=GF RM   11470904
#=GF RT   A conserved RNA structure (thi box) is involved in regulation of
#=GF RT   thiamin biosynthetic gene expression in bacteria.
#=GF RA   Miranda-Rios J, Navarro M, Soberon M;
#=GF RL   Proc Natl Acad Sci U S A 2001;98:9736-9741.
#=GF RN   [3]
#=GF RM   12410317
#=GF RT   Thiamine derivatives bind messenger RNAs directly to regulate
#=GF RT   bacterial gene expression.
#=GF RA   Winkler W, Nahvi A, Breaker RR;
#=GF RL   Nature 2002;419:952-956.
#=GF RN   [4]
#=GF RM   12756322
#=GF RT   Metabolite-binding RNA domains are present in the genes of
#=GF RT   eukaryotes.
#=GF RA   Sudarsan N, Barrick JE, Breaker RR;
#=GF RL   RNA 2003;9:644-647.
#=GF RN   [5]
#=GF RM   14675766
#=GF RT   Thiamine-regulated gene expression of Aspergillus oryzae thiA
#=GF RT   requires splicing of the intron containing a riboswitch-like domain
#=GF RT   in the 5'-UTR.
#=GF RA   Kubodera T, Watanabe M, Yoshiuchi K, Yamashita N, Nishimura A, Nakai
#=GF RA   S, Gomi K, Hanamoto H;
#=GF RL   FEBS Lett 2003;555:516-520.
#=GF RN   [6]
#=GF RM   16728979
#=GF RT   Structural basis for gene regulation by a thiamine
#=GF RT   pyrophosphate-sensing riboswitch.
#=GF RA   Serganov A, Polonskaia A, Phan AT, Breaker RR, Patel DJ;
#=GF RL   Nature. 2006;441:1167-1171.
#=GF CC   Vitamin B(1) in its active form thiamin pyrophosphate (TPP) is an
#=GF CC   essential coenzyme that is synthesised by coupling of pyrimidine
#=GF CC   and thiazole moieties in bacteria.  The previously detected
#=GF CC   thiamin-regulatory element, thi box [1] was extended, resulting
#=GF CC   in a new, highly conserved RNA secondary structure, the THI
#=GF CC   element, which is widely distributed in eubacteria and also
#=GF CC   occurs in some archaea. Analysis of operon structures identified
#=GF CC   a large number of new candidate thiamin-regulated genes, mostly
#=GF CC   transporters, in various prokaryotic organisms [2].  The THI
#=GF CC   element is a riboswitch [3] that directly binds to TPP to
#=GF CC   regulate gene expression through a variety of mechanisms in
#=GF CC   archaea, bacteria and eukaryotes [4,5].
#=GF SQ   174

AL445064.1/126097-125991             CUGGUGUGGUGGGGGAGCUCCAUA..........................
AL445066.1/239884-239777             AACUAGGCGAGGGGGAGCUCCAUA..........................
BX248354.1/27456-27566               AGUGUCCCCCGCGGGCGCCCGAGC..........................
BX248356.1/234808-234920             ACGAGAUGCCCGG.GUGCCAUGUGCUUGCUGU..................
BX927152.1/148798-148691             AUACUAGGCACGGGGUGCCAACCGGAUGGAAAAAUUC.............
BX248356.1/232868-232999             UUUAUAAAUCACGGGUGCUGGACGGCAUACGUUUGCC.............
AY102616.1/4667-4777                 GGCAGUCCCCACGGGCGCCCGAGC..........................
AL583918.1/38806-38668               ACUUCAGUACACGGGAGUCCCCAGGCAGUCCGAAUCU.............
AL583918.1/33385-33496               AAAAAACCACGCGGGAGCACACACCA........................
AE017241.1/138845-138735             UCCAUCAGACGCGGGAGCGCACGCCA........................
AE017241.1/124587-124696             CGUUUUAGACACGGGAGUCCCGGGAC........................
BX842573.1/159140-159250             CCCUGUAGACACGGGAGUCCCGGGAG........................
BX842573.1/168419-168309             GGGUACCCACGCGGGAGCGCACGCCG........................
AD000014.1/41361-41472               GGGUACCCACGCGGGAGCGCAACGCCG.......................
AL939118.1/94624-94813               CUUUGUACACGCGGGAGCUCGGAGC.........................
AL939124.1/163164-163269             AUAUUCCGACAGGGGAGCGCCA............................
AL939111.1/162719-162830             CAAGGCACUCGCGGGAGCCCGGACGC........................
AE016935.1/265475-265571             UUCACUAAGUAGGGGUGCCUUAACAU........................
AE016928.1/199416-199321             GUAAAGACAAAGGGGUGCCCCCAAA.........................
AE016935.1/279858-279954             UUCACGCAAUAGGGGUGCCCUAACAU........................
AE017178.1/187260-187147             AAUUGGGAGAAGGGGUGCUUCCUGUAGCAAUCGGAAUGCGU.........
AE017179.1/109208-109098             AGACCGCUACGGGGGUGCUUGCCGGCAAGAAUUGCGAUAC..........
BX569689.1/134905-135013             AAACACCACUAGGGGUGCCUCGAUCGGUUUUCUGGUCG............
BX572094.1/147473-147375             AAAUAUAACUAGGGGUGCUAAGUCAAUU......................
AE017166.1/115998-115896             AAAUAUCACUAGGGGUGCCUACAAGCUAUUGC..................
BX572095.1/178356-178459             GCAAAACACUAGGGGUGCCAUUCAGCAAUCGCU.................
AE001887.1/9104-9203                 UCGCGUCACCGGGGGUGCCCUGCUUCGG......................
AE001862.1/178389-178274             CAUCGUCAACAGGGGUGCCUCCGCAUAUGGGC..................
X54035.1/52-153                      GAUGACCACAAGGGGAGCAUU.............................
Z99112.2/3782-3883                   GAUUCAUCCUAGGGGUGCUUUG............................
Z99119.2/164687-164788               GAUGACCACAAGGGGAGCAUU.............................
U81371.1/247-152                     AAAAAACUAUUAGGGUGCCCGUAG..........................
Z82044.1/19193-19300                 AAUAGUUACUGGGGGUGCCCGCUU..........................
Z99110.2/31833-31941                 UUUAACCACUAGGGGUGUCCUUCA..........................
U64312.1/2271-2374                   UAGUUCCACUAGGGGUGUCAGUUU..........................
AJ002571.1/43977-43865               GGAAAGCACUAGGGGUGCUGU.............................
M73546.1/221-329                     UUUAACCACUAGGGGUGUCCUUCA..........................
AE017026.1/171648-171751             UGAAACCACUAGGGGUGCUUG.............................
AE016999.1/106602-106704             AAUUAAGGACCGGGGAGCCAA.............................
AE017025.1/103946-104055             AAUAAGCAC.AUGGGAGUUUGUGGA.........................
AE016999.1/97492-97606               UAAGAAACACAUGGGAGUUUGUGGA.........................
AE017013.1/198598-198699             CGUUAUCACUGGGGGAGCCAU.............................
AE017000.1/120837-120948             AUAGUUUGCUAGGAGAGCUGGUGU..........................
AE017000.1/121009-121112             UGAAACCACUAGGGGUGCUUG.............................
AE017025.1/109350-109452             AAUUAAGGACCGGGGAGCCAA.............................
AE017006.1/104897-105002             UUCAUCCACUAGGGGGGCCUUUU...........................
AE017040.1/281858-281743             GUGAUAAACUAGGGGUGCCUAACGUAUG......................
AE017281.1/27688-27573               GUGAUAAACUAGGGGUGCCUAACGUAUG......................
AE017265.1/213026-213137             UACUAAACACAUGGGAGUUUGUGGA.........................
AE017265.1/218427-218529             AAUUAAGGACCGGGGAGCCAA.............................
AE017279.1/252135-252236             CGUUAUCACAGGGGGAGCCAU.............................
AE017266.1/253092-253204             AUAGUUUGCUAGGAGAGCUGGUGU..........................
AE017272.1/195611-195716             UUUAUCCACUAGGGGGGCCUAUU...........................
AE017266.1/253265-253367             UGAAACCACUAGGGGUGCUUG.............................
AF104225.1/570-680                   CGUUACCACAGGGGGGGCUUC.............................
AL596168.1/251336-251226             CGUUACCACAGGGGGGGCUUC.............................
AL596164.1/123476-123581             AAGAAAAACUAGGGGGGCCGAU............................
AE016744.1/250277-250176             UAGUAUCACUAGGGGUGCAAUUCA..........................
AF269570.1/1830-1729                 UAGUAUCAUUAGGGGUGCAAUUCA..........................
AF269819.1/1816-1718                 AUUUGCUACUAGGGGAGCCAA.............................
AE016746.1/165122-165020             UGAACGCACUAGGGGUGUAUU.............................
AE016745.1/27312-27213               UAUAUGCACUAGGGGUGUUUU.............................
AE016750.1/293855-293964             UUUAACCACUGGAAGUGCCUUUGU..........................
AF109218.1/4405-4502                 UAAAAUUGCUAGGGGCGCCUU.............................
AE015938.1/273488-273596             AAAUAAAUUUAGGGGAGCUUAUAAA.........................
AE007806.1/8808-8702                 AAUAUUUUUCAGGGGAGCUUGUUU..........................
AE007651.1/7649-7751                 UUUUAGUGCUAGGGGUGCCUU.............................
AE007789.1/9122-9015                 AUAUAGUUAACGGGGAGCCUGUAG..........................
AE007798.1/8173-8025                 UAUUUUAGCUAGGGGUGCCUUUUAAGGCUUUUAUAGUUGAUAUCAUUAAA
AE015942.1/58651-58542               AUAAAGUUUCAGGGGAGCUGGUUUA.........................
AE007789.1/11572-11662               UAUAUGUGCUAGGGGUGCCUU.............................
AE015936.1/222874-222760             AUGUAGUGCUAGGGGUGCUAUAU...........................
AE013167.1/14408-14306               UCAAAGUGCUAGGGGAGCCAGA............................
AE013192.1/4947-4844                 UAUGUCCGCUGGGGGAGCCUGA............................
AE013112.1/9358-9256                 CUCAAGUGCUAGGGGAGCCAAA............................
AE013127.1/3291-3189                 CUCAAGUGCUAGGGGAGCCAGA............................
AE016955.1/241328-241238             AAAAAACAUUUGGGGUGCUGU.............................
AE016955.1/248631-248543             GAGAAACAUUUGGGGUGCUA..............................
AE017200.1/98337-98247               UAAAUACAUCUGGGGUGCCUA.............................
AL935252.1/202700-202607             UCAUAGCAACUGGGGUGCCAU.............................
AL935252.1/99249-99354               UUUAAACACUAGGGGUGUCCAAAA..........................
AF159589.1/4059-4150                 ACCUUCACAAAGGGGAGCCA..............................
AE006268.1/10610-10511               UAUUUGCACAAUGGGUCUAUUGACAAAACUG...................
AE008441.1/13586-13488               AACAACCACUAGGGGUGCGU..............................
AB042239.3/9807-9660                 AGGCGUCACAAGAGGAGCUU..............................
AE008564.1/13544-13464               UACAGUCUGAGAGGAAGUGU..............................
AE014229.1/2499-2401                 AAAUACACAAGGGAGUGCCU..............................
AE008441.1/6797-6885                 UAAAGACAUUUGGGGUGCUU..............................
AL766847.1/94269-94358               AUAGGACAUUUGGGGUGCGUA.............................
AE014913.1/8949-8849                 AAAUAUCACAAGGAGUGCUAAC............................
AE007380.1/3446-3534                 UAGAGACAUUUGGGGUGCUU..............................
AE008441.1/3915-4003                 UAGAGACAUUUGGGGUGCUU..............................
AE014230.1/102-191                   AUAGGACAUUUGGGGUGCGUA.............................
AE010000.1/5636-5540                 UAUUUCACAAAGGAGUGCUU..............................
AE007508.1/3048-2943                 CAUAUAAUAUAUGGGAGUCUGUGU..........................
AE016968.1/6411-6516                 AAUCAAUAACAGAGGUACCUCUUUUAUCUUGGAUAA..............
BX842644.1/215451-215359             UAAAGUAAAUAAGGGUGCUGUA............................
M37339.1/618-707                     UUAUUUCAACAGGGGAGCUGUA............................
AL445564.1/265255-265358             AAACAUAGACAGGGGUACUUAUCUAUCAAAAAUAG...............
AL445563.1/260054-259948             UAACAAAGGCAGGGGUACUAUAUCUCACUGAAAAAGUAG...........
AE005876.1/3727-3622                 GUCUGUUCACCGGGGGGCCGCUCG..........................
BX572604.1/199848-199986             GCCCGUUCCGAGGGGGGCUCCGAC..........................
AE009471.1/6144-5974                 GUCGCUCUAACGGGGUGCCAUCUGCUUUUGG...................
AE009607.1/63-169                    CAAAAUUCGUUGGGGUGCCUUGAA..........................
AL672115.1/15647-15763               CGCAUUCACCAGGGGAGUCCCGGC..........................
AE009258.1/7675-7777                 AGCUCUUCCGAGGGGAGCACCAGA..........................
AE008184.1/8540-8430                 CUUGAUCUAACGGGGUGUCUUCUGUGCUUUUGUGC...............
AE009203.1/4053-3942                 GCCAUUCACCAGGGGUGUCCCGUC..........................
AF004408.1/427-558                   ACCAUUCACCAGGGGUGCCCCGGC..........................
AY316746.1/2276-2378                 CUCCAUUCCGAGGGGAGCGCCGGG..........................
AF070520.1/2088-2190                 GCGCAUUCCGAGGGGAGCACUAGA..........................
AL591793.1/152515-152628             GCUGCUCUAACGGGGUGCCCUGGCCGGCUUUGCGA...............
AE017257.1/202839-202737             UACACGCAUUAGGGGUGCUCUAG...........................
BX640423.1/313922-313811             AGGAUCACGCAGGGGUACUCGCUGUCCCGCCUUCAAGGCCGGC.......
AL646057.1/132458-132357             UGGAUGAAACAGGGGUGCCGUGCGGAUGGGCC..................
AE016921.1/114001-113907             CCCUGUCACCGGGGGUGCCCGCCA..........................
AE016910.1/243048-243195             CGGCAUCGCUAGGGGUCCUGCGCCUGGCGUUCGGCGCAGAUGGCUAGCAA
AL162752.2/339009-338906             GCUUUCUUGUCGGAGUGCCGCCGCC.........................
AL162753.2/24984-25083               ACAUCGAAACAGGGGUGCUGCCUGAUGUUC....................
BX321856.1/50120-50227               AGCUGUGGCUAGGGGUCCGCAUUUGCAGUUUUCUGCAA............
BX842649.1/277414-277318             ACCUGACGCUAGGGGUGUUGGUGAAUU.......................
AL139075.2/104313-104417             AACAUAAAUGACGGGAGCUUGUGU..........................
AE001547.1/1336-1446                 GGAGCAUUUAAGGGGUGCUUUUUAAAACGCUCAAGUUUUU..........
AE000633.1/3712-3819                 AGCAUUUA..AGGGGUGCUUUUUAAAACGCUCAAGUUUUU..........
M16495.1/2120-2233                   GCCAUCUUGUCGGAGUGCCAACCGUCGAACGAC.................
AE015710.1/12073-11979               UGUUUGCCAAA....AUUCGG.............................
AE015685.1/10697-10614               UGCCUUUUGGCUGAGACCGUUU............................
S54369.1/6984-7152                   CCAUACUGCUGGGGGUGUCCGUGACGACCCGCUCGGCUUGGAUUUUCGGC
AY123045.1/16666-16547               AGUCCCUGUCAGGGGAGUCUCGCCA.........................
AF264948.1/14680-14561               GGUUCCUGUCAGGGGAGUCUCGCCA.........................
AE016755.1/79951-79852               CCGUUCUCAACGGGGUGCCACGCAGCC.......................
D10483.2/75274-75175                 CCGUUCUCAACGGGGUGCCACGCGUAC.......................
AE016763.1/55154-55058               CCAAACGACUCGGGGUGCCCUUCUUUG.......................
BX571860.1/177712-177587             ACUUUCUUGUCGGAGUGCCUAGCGUAAGCUGUUUUAUCGCAGCAUA....
BX571861.1/7126-7022                 GCCAUCUCAACGGGGUGCUGGCUGUUUAAAACA.................
AL627279.1/105836-106061             GUUAUCUUGUCGGAGUGCUAAUUUUCCACAAAAGCGUUCGUGAUGCGUCA
AL627265.1/128216-128117             CCGAACUCAACGGGGUGCCGCGCUCAU.......................
AE016836.1/195900-195996             CUUGACGACUCGGGGUGCCCUUCUUUG.......................
AE016985.1/136499-136403             CCAAACGACUCGGGGUGCCCUUCUGCG.......................
AE016978.1/72938-72839               CCGUUCUCAACGGGGUGCCACGCAAAC.......................
AJ414158.1/174343-174468             AGGCUCUUGUCGGAGUGCCUAGCACCUGCUUUUUUAGGAAAGCAAA....
AJ414154.1/26151-26047               CAUUCUGACUCGGGGUGCCUGCCACAAUGCGGUG................
AE013968.1/546-637                   ACCACCUAACCGC..CGCAAUUUU..........................
U32725.1/470-558                     GACUUUUAGUCGGGGUGCCGA.............................
U32720.1/1366-1454                   AGUUUUUAGUCGGGGUGCCGA.............................
AE017152.1/157588-157680             UUGUUCUCAUUGGGGUGCUGAAA...........................
U32782.1/8310-8397                   AAAGCCUAGUCGGGGUGCAA..............................
AB087258.1/15478-15568               CCGACUUAGUCGGGGUGCUGAU............................
AE006074.1/48-140                    GACUCUUAGUCGGGGUGCUAUUGC..........................
AE006165.1/9171-9068                 GCACUUUAGUCGGGGUGCUUUGUAACCAAAUUGU................
AE016785.1/288775-288889             AGCGCCACCAAGGGGAGCCCGGCA..........................
AE016792.1/163969-163863             AUGUUCUUGUCGGGGUGCCUUGAAG.........................
AE004910.1/5287-5151                 GGGUUCUUGUCGGGGUGCCCUAUAC.........................
AE004209.1/3442-3690                 GUCCUGUAGUCGGGGAGCCUGAGAGCGUAUAUACCCUUCUUACUUGAAGC
AE004097.1/4180-4278                 UUCCACUUGUCGGAGUGCCAU.............................
AE016800.1/67341-67243               UUUCACUUGUCGGAGUGCCUU.............................
AE012449.1/4930-4832                 CCGCCGAAGUGGGGGUACCACAGCACUG......................
AE011991.1/4930-4833                 CCGCCGAAGUGGGGGUACCGCAGCGUG.......................
AE004009.1/105-203                   GCUUUGAAGCGGGGGUACCAUAGCCAAG......................
AE012556.1/212138-212040             ACUUUGAAGCGGGGGUACCGUAGCCAAG......................
AE011282.1/7576-7478                 CUUGGACGUUGGGGGUGGGAUUCACUGCGU....................
AE001747.1/6884-6993                 ACCUUCCCCAGGGGGAGCUCCUAUU.........................
AB111809.1/311-481                   UCUGGGCGUGGCCGGUGUUCGUUCUUAUCCUUAGCAUAUCCCUACCUCAA
AF217503.1/595-688                   ACAUGGCAUCGAUGGACUGGGU............................
AB118748.1/319-422                   UGGAGGGGUACCGGGUGUACGAGGCAGAGUCCG.................
M33642.1/428-524                     GUGUACAUCAA....UGUCAAGAAGAGGAGA...................
AB033416.1/2076-2219                 UCAUGCAUGAGCCGGUGCCCAUUCUUCUCCCAUCAGCAUGGUCAGUUCAA
AY007661.1/532-727                   AAGACAGCUACCGGGUGUCCAUGUUGGUACAGCCACAGUUGGUUCACCCU
AC084406.7/91434-91300               AAGUUGCACCAGGGGUGCCUGUAUUCUCAACGAUCUGAAGGCCUCUUGGC
AK068703.1/2083-2217                 UGUUAGGAGGUGGGGUGCCUGUAUUCUCAACGAUCUGAAGGCCUCUUGGC
AK119882.1/1-98                      UUGAAUGACUCGGGGUGCCCCUUUUCAC......................
AK120238.1/2075-2184                 CUAUGUUAGGAGGUGGCCUCUUGGCCUGGAUUGUUGUGA...........
AF264021.1/2226-2360                 AAGUUGCACCAGGGGUGCCUGUAUUCUCAACAAUCUGAAGGGCCCUUGGC
AC005496.3/78625-78498               CAAAAGCACCAGGGGUGCUUGAACCAGGAUAGCCUGCGAAAAGGCGGGCU
#=GC SS_cons                         .....<<<<<<<<<..<<<<<<............................

AL445064.1/126097-125991             ..................................................
AL445066.1/239884-239777             ..................................................
BX248354.1/27456-27566               ..................................................
BX248356.1/234808-234920             ..................................................
BX927152.1/148798-148691             ..................................................
BX248356.1/232868-232999             ..................................................
AY102616.1/4667-4777                 ..................................................
AL583918.1/38806-38668               ..................................................
AL583918.1/33385-33496               ..................................................
AE017241.1/138845-138735             ..................................................
AE017241.1/124587-124696             ..................................................
BX842573.1/159140-159250             ..................................................
BX842573.1/168419-168309             ..................................................
AD000014.1/41361-41472               ..................................................
AL939118.1/94624-94813               ..................................................
AL939124.1/163164-163269             ..................................................
AL939111.1/162719-162830             ..................................................
AE016935.1/265475-265571             ..................................................
AE016928.1/199416-199321             ..................................................
AE016935.1/279858-279954             ..................................................
AE017178.1/187260-187147             ..................................................
AE017179.1/109208-109098             ..................................................
BX569689.1/134905-135013             ..................................................
BX572094.1/147473-147375             ..................................................
AE017166.1/115998-115896             ..................................................
BX572095.1/178356-178459             ..................................................
AE001887.1/9104-9203                 ..................................................
AE001862.1/178389-178274             ..................................................
X54035.1/52-153                      ..................................................
Z99112.2/3782-3883                   ..................................................
Z99119.2/164687-164788               ..................................................
U81371.1/247-152                     ..................................................
Z82044.1/19193-19300                 ..................................................
Z99110.2/31833-31941                 ..................................................
U64312.1/2271-2374                   ..................................................
AJ002571.1/43977-43865               ..................................................
M73546.1/221-329                     ..................................................
AE017026.1/171648-171751             ..................................................
AE016999.1/106602-106704             ..................................................
AE017025.1/103946-104055             ..................................................
AE016999.1/97492-97606               ..................................................
AE017013.1/198598-198699             ..................................................
AE017000.1/120837-120948             ..................................................
AE017000.1/121009-121112             ..................................................
AE017025.1/109350-109452             ..................................................
AE017006.1/104897-105002             ..................................................
AE017040.1/281858-281743             ..................................................
AE017281.1/27688-27573               ..................................................
AE017265.1/213026-213137             ..................................................
AE017265.1/218427-218529             ..................................................
AE017279.1/252135-252236             ..................................................
AE017266.1/253092-253204             ..................................................
AE017272.1/195611-195716             ..................................................
AE017266.1/253265-253367             ..................................................
AF104225.1/570-680                   ..................................................
AL596168.1/251336-251226             ..................................................
AL596164.1/123476-123581             ..................................................
AE016744.1/250277-250176             ..................................................
AF269570.1/1830-1729                 ..................................................
AF269819.1/1816-1718                 ..................................................
AE016746.1/165122-165020             ..................................................
AE016745.1/27312-27213               ..................................................
AE016750.1/293855-293964             ..................................................
AF109218.1/4405-4502                 ..................................................
AE015938.1/273488-273596             ..................................................
AE007806.1/8808-8702                 ..................................................
AE007651.1/7649-7751                 ..................................................
AE007789.1/9122-9015                 ..................................................
AE007798.1/8173-8025                 AAUAUUUAACUAAUAAAAGAC.............................
AE015942.1/58651-58542               ..................................................
AE007789.1/11572-11662               ..................................................
AE015936.1/222874-222760             ..................................................
AE013167.1/14408-14306               ..................................................
AE013192.1/4947-4844                 ..................................................
AE013112.1/9358-9256                 ..................................................
AE013127.1/3291-3189                 ..................................................
AE016955.1/241328-241238             ..................................................
AE016955.1/248631-248543             ..................................................
AE017200.1/98337-98247               ..................................................
AL935252.1/202700-202607             ..................................................
AL935252.1/99249-99354               ..................................................
AF159589.1/4059-4150                 ..................................................
AE006268.1/10610-10511               ..................................................
AE008441.1/13586-13488               ..................................................
AB042239.3/9807-9660                 ..................................................
AE008564.1/13544-13464               ..................................................
AE014229.1/2499-2401                 ..................................................
AE008441.1/6797-6885                 ..................................................
AL766847.1/94269-94358               ..................................................
AE014913.1/8949-8849                 ..................................................
AE007380.1/3446-3534                 ..................................................
AE008441.1/3915-4003                 ..................................................
AE014230.1/102-191                   ..................................................
AE010000.1/5636-5540                 ..................................................
AE007508.1/3048-2943                 ..................................................
AE016968.1/6411-6516                 ..................................................
BX842644.1/215451-215359             ..................................................
M37339.1/618-707                     ..................................................
AL445564.1/265255-265358             ..................................................
AL445563.1/260054-259948             ..................................................
AE005876.1/3727-3622                 ..................................................
BX572604.1/199848-199986             ..................................................
AE009471.1/6144-5974                 ..................................................
AE009607.1/63-169                    ..................................................
AL672115.1/15647-15763               ..................................................
AE009258.1/7675-7777                 ..................................................
AE008184.1/8540-8430                 ..................................................
AE009203.1/4053-3942                 ..................................................
AF004408.1/427-558                   ..................................................
AY316746.1/2276-2378                 ..................................................
AF070520.1/2088-2190                 ..................................................
AL591793.1/152515-152628             ..................................................
AE017257.1/202839-202737             ..................................................
BX640423.1/313922-313811             ..................................................
AL646057.1/132458-132357             ..................................................
AE016921.1/114001-113907             ..................................................
AE016910.1/243048-243195             AGUGUAGGCCAUGGCGGCGGAUGACGGA......................
AL162752.2/339009-338906             ..................................................
AL162753.2/24984-25083               ..................................................
BX321856.1/50120-50227               ..................................................
BX842649.1/277414-277318             ..................................................
AL139075.2/104313-104417             ..................................................
AE001547.1/1336-1446                 ..................................................
AE000633.1/3712-3819                 ..................................................
M16495.1/2120-2233                   ..................................................
AE015710.1/12073-11979               ..................................................
AE015685.1/10697-10614               ..................................................
S54369.1/6984-7152                   GCUGGGCGCUCAGACGUCCAGCCGCUAUCCCUGCCGAGAGUUUCGCGU..
AY123045.1/16666-16547               ..................................................
AF264948.1/14680-14561               ..................................................
AE016755.1/79951-79852               ..................................................
D10483.2/75274-75175                 ..................................................
AE016763.1/55154-55058               ..................................................
BX571860.1/177712-177587             ..................................................
BX571861.1/7126-7022                 ..................................................
AL627279.1/105836-106061             AGGCGGCAAGUCGGUGAAUCUCCAGGAGCUUACAUAAGUAAGUGACUGGA
AL627265.1/128216-128117             ..................................................
AE016836.1/195900-195996             ..................................................
AE016985.1/136499-136403             ..................................................
AE016978.1/72938-72839               ..................................................
AJ414158.1/174343-174468             ..................................................
AJ414154.1/26151-26047               ..................................................
AE013968.1/546-637                   ..................................................
U32725.1/470-558                     ..................................................
U32720.1/1366-1454                   ..................................................
AE017152.1/157588-157680             ..................................................
U32782.1/8310-8397                   ..................................................
AB087258.1/15478-15568               ..................................................
AE006074.1/48-140                    ..................................................
AE006165.1/9171-9068                 ..................................................
AE016785.1/288775-288889             ..................................................
AE016792.1/163969-163863             ..................................................
AE004910.1/5287-5151                 ..................................................
AE004209.1/3442-3690                 UGCAGCGGUGUUGGCUACGUUCGUUCACCCCAAUCACAUAGUUUAUCUAU
AE004097.1/4180-4278                 ..................................................
AE016800.1/67341-67243               ..................................................
AE012449.1/4930-4832                 ..................................................
AE011991.1/4930-4833                 ..................................................
AE004009.1/105-203                   ..................................................
AE012556.1/212138-212040             ..................................................
AE011282.1/7576-7478                 ..................................................
AE001747.1/6884-6993                 ..................................................
AB111809.1/311-481                   CUGUACUGGCCUUUAUCCAGCGUUGAAGGGGACUGCCAAAGGCUCUGGG.
AF217503.1/595-688                   ..................................................
AB118748.1/319-422                   ..................................................
M33642.1/428-524                     ..................................................
AB033416.1/2076-2219                 ACUGGUCGUGUUGAUGAUAGGGGG..........................
AY007661.1/532-727                   UAUCGCUCUUCCAUGCCUUCUGUGACAAGGUCUUUGGAAUGAGUUUGAUA
AC084406.7/91434-91300               CUGGAUUGUUGUGA....................................
AK068703.1/2083-2217                 CUGGAUUGUUGUGA....................................
AK119882.1/1-98                      ..................................................
AK120238.1/2075-2184                 ..................................................
AF264021.1/2226-2360                 CUGGAUUGUUGUGA....................................
AC005496.3/78625-78498               AUCCGGG...........................................
#=GC SS_cons                         ..................................................

AL445064.1/126097-125991             ..................................................
AL445066.1/239884-239777             ..................................................
BX248354.1/27456-27566               ..................................................
BX248356.1/234808-234920             ..................................................
BX927152.1/148798-148691             ..................................................
BX248356.1/232868-232999             ..................................................
AY102616.1/4667-4777                 ..................................................
AL583918.1/38806-38668               ..................................................
AL583918.1/33385-33496               ..................................................
AE017241.1/138845-138735             ..................................................
AE017241.1/124587-124696             ..................................................
BX842573.1/159140-159250             ..................................................
BX842573.1/168419-168309             ..................................................
AD000014.1/41361-41472               ..................................................
AL939118.1/94624-94813               ..................................................
AL939124.1/163164-163269             ..................................................
AL939111.1/162719-162830             ..................................................
AE016935.1/265475-265571             ..................................................
AE016928.1/199416-199321             ..................................................
AE016935.1/279858-279954             ..................................................
AE017178.1/187260-187147             ..................................................
AE017179.1/109208-109098             ..................................................
BX569689.1/134905-135013             ..................................................
BX572094.1/147473-147375             ..................................................
AE017166.1/115998-115896             ..................................................
BX572095.1/178356-178459             ..................................................
AE001887.1/9104-9203                 ..................................................
AE001862.1/178389-178274             ..................................................
X54035.1/52-153                      ..................................................
Z99112.2/3782-3883                   ..................................................
Z99119.2/164687-164788               ..................................................
U81371.1/247-152                     ..................................................
Z82044.1/19193-19300                 ..................................................
Z99110.2/31833-31941                 ..................................................
U64312.1/2271-2374                   ..................................................
AJ002571.1/43977-43865               ..................................................
M73546.1/221-329                     ..................................................
AE017026.1/171648-171751             ..................................................
AE016999.1/106602-106704             ..................................................
AE017025.1/103946-104055             ..................................................
AE016999.1/97492-97606               ..................................................
AE017013.1/198598-198699             ..................................................
AE017000.1/120837-120948             ..................................................
AE017000.1/121009-121112             ..................................................
AE017025.1/109350-109452             ..................................................
AE017006.1/104897-105002             ..................................................
AE017040.1/281858-281743             ..................................................
AE017281.1/27688-27573               ..................................................
AE017265.1/213026-213137             ..................................................
AE017265.1/218427-218529             ..................................................
AE017279.1/252135-252236             ..................................................
AE017266.1/253092-253204             ..................................................
AE017272.1/195611-195716             ..................................................
AE017266.1/253265-253367             ..................................................
AF104225.1/570-680                   ..................................................
AL596168.1/251336-251226             ..................................................
AL596164.1/123476-123581             ..................................................
AE016744.1/250277-250176             ..................................................
AF269570.1/1830-1729                 ..................................................
AF269819.1/1816-1718                 ..................................................
AE016746.1/165122-165020             ..................................................
AE016745.1/27312-27213               ..................................................
AE016750.1/293855-293964             ..................................................
AF109218.1/4405-4502                 ..................................................
AE015938.1/273488-273596             ..................................................
AE007806.1/8808-8702                 ..................................................
AE007651.1/7649-7751                 ..................................................
AE007789.1/9122-9015                 ..................................................
AE007798.1/8173-8025                 ..................................................
AE015942.1/58651-58542               ..................................................
AE007789.1/11572-11662               ..................................................
AE015936.1/222874-222760             ..................................................
AE013167.1/14408-14306               ..................................................
AE013192.1/4947-4844                 ..................................................
AE013112.1/9358-9256                 ..................................................
AE013127.1/3291-3189                 ..................................................
AE016955.1/241328-241238             ..................................................
AE016955.1/248631-248543             ..................................................
AE017200.1/98337-98247               ..................................................
AL935252.1/202700-202607             ..................................................
AL935252.1/99249-99354               ..................................................
AF159589.1/4059-4150                 ..................................................
AE006268.1/10610-10511               ..................................................
AE008441.1/13586-13488               ..................................................
AB042239.3/9807-9660                 ..................................................
AE008564.1/13544-13464               ..................................................
AE014229.1/2499-2401                 ..................................................
AE008441.1/6797-6885                 ..................................................
AL766847.1/94269-94358               ..................................................
AE014913.1/8949-8849                 ..................................................
AE007380.1/3446-3534                 ..................................................
AE008441.1/3915-4003                 ..................................................
AE014230.1/102-191                   ..................................................
AE010000.1/5636-5540                 ..................................................
AE007508.1/3048-2943                 ..................................................
AE016968.1/6411-6516                 ..................................................
BX842644.1/215451-215359             ..................................................
M37339.1/618-707                     ..................................................
AL445564.1/265255-265358             ..................................................
AL445563.1/260054-259948             ..................................................
AE005876.1/3727-3622                 ..................................................
BX572604.1/199848-199986             ..................................................
AE009471.1/6144-5974                 ..................................................
AE009607.1/63-169                    ..................................................
AL672115.1/15647-15763               ..................................................
AE009258.1/7675-7777                 ..................................................
AE008184.1/8540-8430                 ..................................................
AE009203.1/4053-3942                 ..................................................
AF004408.1/427-558                   ..................................................
AY316746.1/2276-2378                 ..................................................
AF070520.1/2088-2190                 ..................................................
AL591793.1/152515-152628             ..................................................
AE017257.1/202839-202737             ..................................................
BX640423.1/313922-313811             ..................................................
AL646057.1/132458-132357             ..................................................
AE016921.1/114001-113907             ..................................................
AE016910.1/243048-243195             ..................................................
AL162752.2/339009-338906             ..................................................
AL162753.2/24984-25083               ..................................................
BX321856.1/50120-50227               ..................................................
BX842649.1/277414-277318             ..................................................
AL139075.2/104313-104417             ..................................................
AE001547.1/1336-1446                 ..................................................
AE000633.1/3712-3819                 ..................................................
M16495.1/2120-2233                   ..................................................
AE015710.1/12073-11979               ..................................................
AE015685.1/10697-10614               ..................................................
S54369.1/6984-7152                   ..................................................
AY123045.1/16666-16547               ..................................................
AF264948.1/14680-14561               ..................................................
AE016755.1/79951-79852               ..................................................
D10483.2/75274-75175                 ..................................................
AE016763.1/55154-55058               ..................................................
BX571860.1/177712-177587             ..................................................
BX571861.1/7126-7022                 ..................................................
AL627279.1/105836-106061             GUGAGCGGACGAAGCCAACGAAGAGGCAGCGCGAAGGAUGAAGUGG....
AL627265.1/128216-128117             ..................................................
AE016836.1/195900-195996             ..................................................
AE016985.1/136499-136403             ..................................................
AE016978.1/72938-72839               ..................................................
AJ414158.1/174343-174468             ..................................................
AJ414154.1/26151-26047               ..................................................
AE013968.1/546-637                   ..................................................
U32725.1/470-558                     ..................................................
U32720.1/1366-1454                   ..................................................
AE017152.1/157588-157680             ..................................................
U32782.1/8310-8397                   ..................................................
AB087258.1/15478-15568               ..................................................
AE006074.1/48-140                    ..................................................
AE006165.1/9171-9068                 ..................................................
AE016785.1/288775-288889             ..................................................
AE016792.1/163969-163863             ..................................................
AE004910.1/5287-5151                 ..................................................
AE004209.1/3442-3690                 GCUCAUGGGGAUGAACUCACUUGUCGCCUACCUGCAACUCCAAGUAGUUU
AE004097.1/4180-4278                 ..................................................
AE016800.1/67341-67243               ..................................................
AE012449.1/4930-4832                 ..................................................
AE011991.1/4930-4833                 ..................................................
AE004009.1/105-203                   ..................................................
AE012556.1/212138-212040             ..................................................
AE011282.1/7576-7478                 ..................................................
AE001747.1/6884-6993                 ..................................................
AB111809.1/311-481                   ..................................................
AF217503.1/595-688                   ..................................................
AB118748.1/319-422                   ..................................................
M33642.1/428-524                     ..................................................
AB033416.1/2076-2219                 ..................................................
AY007661.1/532-727                   CGAUGGGCCAACUGCGGCGGUACCAC........................
AC084406.7/91434-91300               ..................................................
AK068703.1/2083-2217                 ..................................................
AK119882.1/1-98                      ..................................................
AK120238.1/2075-2184                 ..................................................
AF264021.1/2226-2360                 ..................................................
AC005496.3/78625-78498               ..................................................
#=GC SS_cons                         ..................................................

AL445064.1/126097-125991             .....................AGGG.GCUGAGAGGAUCCGG.........
AL445066.1/239884-239777             ....................AGGGG.GCUGAGAGGAUCCGG.........
BX248354.1/27456-27566               .....................ACGG.GCUGAGAUUGCGCUGAUGCU....
BX248356.1/234808-234920             ....................ACGUG.GCUGAGACGGCUGU..........
BX927152.1/148798-148691             ....................CGGAG.GCUGAGAAA...............
BX248356.1/232868-232999             ....................ACAAA.GCUGAGACAGGGCGAGAAGACGUG
AY102616.1/4667-4777                 .....................ACGG.GCUGAGAUCGCGCUGAUUSU....
AL583918.1/38806-38668               ....................GCGGG.GCUGAGAGUGGGCACAGCCAGAGU
AL583918.1/33385-33496               ....................AGUGC.GCUGAGAGGACGGAUCGG......
AE017241.1/138845-138735             ....................AGUGU.GCUGAGAGGACGGCUCGG......
AE017241.1/124587-124696             ....................CGGGG.UCUGAGAGUGGGCGCGC.......
BX842573.1/159140-159250             ....................CGGGG.UCUGAGAGUGGGCGCGC.......
BX842573.1/168419-168309             ....................AGUGC.GCUGAGAGGACGGCUCGG......
AD000014.1/41361-41472               ....................AGUGC.GCUGAGAGGACGGCUCGG......
AL939118.1/94624-94813               ....................ACCGG.GCUGAGAGGGCGCUGACCUCCGUC
AL939124.1/163164-163269             .....................CAGC.GCUGAGAGUGCGGCACC.......
AL939111.1/162719-162830             ....................ACCGG.GCUGAGAGGGAGGCUGGC......
AE016935.1/265475-265571             ....................GACGG.GCUGAGAAC...............
AE016928.1/199416-199321             ....................GAGGG.GCUGAGAUU...............
AE016935.1/279858-279954             ....................GACAG.GCUGAGAAC...............
AE017178.1/187260-187147             ....................GGAUG.GCUGAGAAC...............
AE017179.1/109208-109098             ....................GGCAG.GCUGAGAUA...............
BX569689.1/134905-135013             ....................ACGGG.GCUGAGAUC...............
BX572094.1/147473-147375             ....................ACUUA.GCUGAGAUC...............
AE017166.1/115998-115896             ....................UUUUG.GCUGAGAUC...............
BX572095.1/178356-178459             ....................GAGUG.GCUGAGAUC...............
AE001887.1/9104-9203                 ....................CAGCG.GCUGAGAAC...............
AE001862.1/178389-178274             ....................CGGAG.GCUGAGAGGGCAACU.........
X54035.1/52-153                      ......................AAA.GCUGAGAGUGAGCGGUU.......
Z99112.2/3782-3883                   .....................CGAA.GCUGAGAGAGACU...........
Z99119.2/164687-164788               ......................AAA.GCUGAGAGUGAGCGGUU.......
U81371.1/247-152                     ....................UAUGG.GUUUAGAAA...............
Z82044.1/19193-19300                 .....................UCGG.GCUGAGAGAGAAGGCAA.......
Z99110.2/31833-31941                 ....................UAAGG.GCUGAGAUAAAAGUGUG.......
U64312.1/2271-2374                   ....................GUCUG.ACUGAGAGAGGGA...........
AJ002571.1/43977-43865               .....................UUUG.GCUGAGAUAAAGCGCGGAAGAAAC
M73546.1/221-329                     ....................UAAGG.GCUGAGAUAAAAGUGUG.......
AE017026.1/171648-171751             .....................UUGU.GCUGAGAGAGGAAU..........
AE016999.1/106602-106704             ......................UUG.GCUGAGAGGAUGUAAGU.......
AE017025.1/103946-104055             ....................UGCAA.ACUGAGAGUAUGACUAUUC.....
AE016999.1/97492-97606               ....................UACAA.ACUGAGAGUAUGGCUACUAGUC..
AE017013.1/198598-198699             ......................GCC.GCUGAGAGGGAACACU........
AE017000.1/120837-120948             ....................UGCCA.GCUGAGAGUAGGCCGUA.......
AE017000.1/121009-121112             .....................ACUU.GCUGAGAGAGGAAU..........
AE017025.1/109350-109452             ......................UUG.GCUGAGAGGAUGUGAGC.......
AE017006.1/104897-105002             .....................AUAG.GCUGAGAUCAAAUGUG........
AE017040.1/281858-281743             ....................CGUAG.GCUGAGAGAGAAGCGCGUAA....
AE017281.1/27688-27573               ....................CGUAG.GCUGAGAGAGAAGCGCGUGA....
AE017265.1/213026-213137             ....................UACAA.ACUGAGAGUAUGACUAGUC.....
AE017265.1/218427-218529             ......................UUG.GCUGAGAGGAUGUGAGU.......
AE017279.1/252135-252236             ......................GCC.GCUGAGAGGGAACACU........
AE017266.1/253092-253204             ....................UGCCA.GCUGAGAGUAAGGCCUUA......
AE017272.1/195611-195716             .....................AUAG.GCUGAGAUCAAAUUGG........
AE017266.1/253265-253367             .....................UUGU.GCUGAGAGAGGAAU..........
AF104225.1/570-680                   ......................UUA.GCUGAGAUUGAGUCCACGUGUUUU
AL596168.1/251336-251226             ......................UUA.GCUGAGAUUGAAUCCGCGUGUUUU
AL596164.1/123476-123581             .....................UCUG.GCUGAGAUAGGAAGGUAAU.....
AE016744.1/250277-250176             .....................AUUU.GCUGAGAGAAAGUC..........
AF269570.1/1830-1729                 .....................AUUU.GCUGAGAGAAAGUC..........
AF269819.1/1816-1718                 ......................AAG.GCUGAGAUGAAUG...........
AE016746.1/165122-165020             .....................CUUU.ACUGAGAUGAGGCC..........
AE016745.1/27312-27213               ......................UUA.ACUGAGAUGGAUA...........
AE016750.1/293855-293964             ....................UUAAG.GCUGAGAGUAAAGAACUG......
AF109218.1/4405-4502                 ......................UUG.GCUGAGAUAGUUU...........
AE015938.1/273488-273596             ....................AAUAG.GCUGAGAAAGAGAUGU........
AE007806.1/8808-8702                 .....................UCAG.GCUGAGAGGAAGUAAUU.......
AE007651.1/7649-7751                 ......................UUG.GCUGAGAGAAGUUAAA........
AE007789.1/9122-9015                 .....................ACAG.GCUGAGAGUGGAAUGU........
AE007798.1/8173-8025                 ....................UUUAG.GCUGAGAGGAGA............
AE015942.1/58651-58542               ....................UGUCA.GCUGAGAGUAAGAACUAA......
AE007789.1/11572-11662               ......................UAG.GCUGAGAAACAGUUUG........
AE015936.1/222874-222760             .....................AAGA.GCUGAGAAAUGAAUUAUUUAUGAU
AE013167.1/14408-14306               .....................AAUG.GCUGAGAGGGGAUU..........
AE013192.1/4947-4844                 .....................AAAG.GCUGAGACGGCAGA..........
AE013112.1/9358-9256                 .....................AAUG.GCUGAGAGGGGAUU..........
AE013127.1/3291-3189                 .....................AAUG.GCUGAGAGGGGAUU..........
AE016955.1/241328-241238             .....................UAUG.GCUGAGAU................
AE016955.1/248631-248543             ......................UUA.GCUGAGAUU...............
AE017200.1/98337-98247               .....................UCGG.GCUGAGAAU...............
AL935252.1/202700-202607             .....................CACG.GCUGAGAUA...............
AL935252.1/99249-99354               .....................AUGG.GCUGAGAUGGUGCUGUA.......
AF159589.1/4059-4150                 ......................UUG.GCUGAGAACGGGG...........
AE006268.1/10610-10511               ....................UCAGU.AGCGAGAA................
AE008441.1/13586-13488               ......................AAA.GCUGAGAUUAACGA..........
AB042239.3/9807-9660                 .......................UU.GCUGAGAAUGACCUCCAGUUUUAA
AE008564.1/13544-13464               ......................UAA.ACU....UC...............
AE014229.1/2499-2401                 ......................UGA.GCUGAGAUUGCAGA..........
AE008441.1/6797-6885                 ......................UAG.GCUGAGAU................
AL766847.1/94269-94358               ......................ACA.GCUGAGAUU...............
AE014913.1/8949-8849                 .....................CUUA.GCUGAGAUUGCAU...........
AE007380.1/3446-3534                 ......................UAG.GCUGAGAUA...............
AE008441.1/3915-4003                 ......................UAA.GCUGAGAU................
AE014230.1/102-191                   ......................ACA.GCUGAGAUU...............
AE010000.1/5636-5540                 .......................UG.GCUGAGAUCGCAA...........
AE007508.1/3048-2943                 .....................ACAG.UCUGAGAGGAAGUGUU........
AE016968.1/6411-6516                 ....................AAGAA.GUUGAGAA................
BX842644.1/215451-215359             .....................AAAG.GCUGAGAUU...............
M37339.1/618-707                     .....................AAAG.GCUGAGAA................
AL445564.1/265255-265358             ....................AUAUG.GUUGAGAUC...............
AL445563.1/260054-259948             ....................GUAUG.GUUGAGAA................
AE005876.1/3727-3622                 .....................CGCG.GCUGAGAUUGGGCUC.........
BX572604.1/199848-199986             ....................GAGGA.GCUGAGAUACCGCACGCUCGCCGC
AE009471.1/6144-5974                 ....................GGAUG.GCUGAGAGGCCAAACAAGGCAUUU
AE009607.1/63-169                    .....................AGAG.GCUGAGAGACGCAUUC........
AL672115.1/15647-15763               ....................AAGGG.GCUGAGAUACUGCUGGCUUUCGCG
AE009258.1/7675-7777                 .....................CGGU.GCUGAGAUGGUGG...........
AE008184.1/8540-8430                 ....................AGAAG.GCUGAGAGGCU.............
AE009203.1/4053-3942                 ....................AAGGG.GCUGAGAUUCUGCUUUCAU.....
AF004408.1/427-558                   ....................AAGGG.GCUGAGAUUCUGCUGAACAAUACG
AY316746.1/2276-2378                 .....................CGGC.GCUGAGACGGCGG...........
AF070520.1/2088-2190                 .....................CGGU.GCUGAGAUGGCGU...........
AL591793.1/152515-152628             ....................CCAUG.GCUGAGAGGCUUC...........
AE017257.1/202839-202737             .....................AAAA.GCUGAGAGUACAU...........
BX640423.1/313922-313811             ....................AGCGU.GUUGAGAG................
AL646057.1/132458-132357             ....................GCGCG.GCUGAGAG................
AE016921.1/114001-113907             ....................UGCGG.GCUGAGAG................
AE016910.1/243048-243195             ....................GCGCG.GGUGAGAA................
AL162752.2/339009-338906             ....................GGGCG.GCUGAGAUUGCGA...........
AL162753.2/24984-25083               ....................AGGCG.GCUGAGAA................
BX321856.1/50120-50227               ....................AUGCC.GGUGAGAG................
BX842649.1/277414-277318             ....................CACCG.ACUGAGAA................
AL139075.2/104313-104417             ....................AACAG.GCUGAGAGUAAGCUAA........
AE001547.1/1336-1446                 ....................AAAAG.GCUGAGAUC...............
AE000633.1/3712-3819                 ....................AAAAG.GCUGAGAUC...............
M16495.1/2120-2233                   ....................GCGAG.GCUGAGACCGUUA...........
AE015710.1/12073-11979               ......................CAG.ACUGAGAUGUCAU...........
AE015685.1/10697-10614               .....................AUUC.GG......................
S54369.1/6984-7152                   ....................CUCGG.GCUGAGAAA...............
AY123045.1/16666-16547               ....................GAGAG.ACUGAGAGGCUAAUAGCGAUUUUC
AF264948.1/14680-14561               ....................GAGAG.ACUGAGAGGCUGAUAGCGAUUUUC
AE016755.1/79951-79852               ....................GCGUGCGCUGAGAAA...............
D10483.2/75274-75175                 ....................GCGUGCGCUGAGAAA...............
AE016763.1/55154-55058               ....................UGAAG.GCUGAGAA................
BX571860.1/177712-177587             ....................CACAG.GCUGAGACCGUUA...........
BX571861.1/7126-7022                 ....................GCCUU.GCUGAGAGU...............
AL627279.1/105836-106061             ....................AAAAG.GCUGAGACCGUUA...........
AL627265.1/128216-128117             ....................GCGCGCGCUGAGAAA...............
AE016836.1/195900-195996             ....................UGAAG.GCUGAGAA................
AE016985.1/136499-136403             ....................UGAAG.GCUGAGAA................
AE016978.1/72938-72839               ....................GCGUGCGCUGAGAAA...............
AJ414158.1/174343-174468             ....................CGCAG.GCUGAGACCGUUA...........
AJ414154.1/26151-26047               ....................GUAAG.GCUGAGAGA...............
AE013968.1/546-637                   .....................UUUC.GCUGAGAGU...............
U32725.1/470-558                     ......................AAG.GCUGAGAU................
U32720.1/1366-1454                   ......................AAG.GCUGAGAU................
AE017152.1/157588-157680             .....................AUAA.GCUGAGAA................
U32782.1/8310-8397                   ......................UAC.GCUGAGAUC...............
AB087258.1/15478-15568               .....................AACA.GCUGAGAUA...............
AE006074.1/48-140                    .....................GUUA.GCUGAGAU................
AE006165.1/9171-9068                 ....................ACAAA.GCUGAGAU................
AE016785.1/288775-288889             .....................AUGG.GCUGAGAAACCGCUGAACGCUACA
AE016792.1/163969-163863             ....................CAAAG.GCUGAGAUCGCAGA..........
AE004910.1/5287-5151                 ....................GAGGG.GCUGAGAUCGGAUA..........
AE004209.1/3442-3690                 GGGUAUAACAACGUGCGAAUUAAAG.GCUGAGAUCGCG............
AE004097.1/4180-4278                 ......................UGG.GCUGAGACCGUUU...........
AE016800.1/67341-67243               ......................AGG.GCUGAGACCGUUU...........
AE012449.1/4930-4832                 ....................CUGCG.GUUGAGAU................
AE011991.1/4930-4833                 ....................CUGCG.GUUGAGAU................
AE004009.1/105-203                   ....................CUGCG.GUUGAGAC................
AE012556.1/212138-212040             ....................CUGCG.GUUGAGAC................
AE011282.1/7576-7478                 ....................GAAUC.UCUGAGAG................
AE001747.1/6884-6993                 ....................CCGGG.GCUGAGAGGAGGACGGA.......
AB111809.1/311-481                   ....................UUCGU.UCUGAGAAU...............
AF217503.1/595-688                   .....................UCGU.UCUGAGAUU...............
AB118748.1/319-422                   ....................GUCGU.UCUGAGAUU...............
M33642.1/428-524                     ....................GCGUG.GCUGAGAUU...............
AB033416.1/2076-2219                 ....................AUGUG.GCUGAGAUU...............
AY007661.1/532-727                   ....................GUUGG.UCUGAGAA................
AC084406.7/91434-91300               ....................AUUGG.GCUGAGAA................
AK068703.1/2083-2217                 ....................AUUGG.GCUGAGAA................
AK119882.1/1-98                      ....................AAAGG.GCUGAGAA................
AK120238.1/2075-2184                 ....................AUUGG.GCUGAGAA................
AF264021.1/2226-2360                 ....................UAUGG.GCUGAGAA................
AC005496.3/78625-78498               ....................ACCAG.GCUGAGAA................
#=GC SS_cons                         .....................>>>>.>>.....<<<<<<...........

AL445064.1/126097-125991             ..................................................
AL445066.1/239884-239777             ..................................................
BX248354.1/27456-27566               ..................................................
BX248356.1/234808-234920             ..................................................
BX927152.1/148798-148691             ..................................................
BX248356.1/232868-232999             CAC...............................................
AY102616.1/4667-4777                 ..................................................
AL583918.1/38806-38668               GACUGAAC..........................................
AL583918.1/33385-33496               ..................................................
AE017241.1/138845-138735             ..................................................
AE017241.1/124587-124696             ..................................................
BX842573.1/159140-159250             ..................................................
BX842573.1/168419-168309             ..................................................
AD000014.1/41361-41472               ..................................................
AL939118.1/94624-94813               CCAGCGAUGUUUCACGGGAAACGUCACCGAAGUCGAGUGACGUAUCCCAC
AL939124.1/163164-163269             ..................................................
AL939111.1/162719-162830             ..................................................
AE016935.1/265475-265571             ..................................................
AE016928.1/199416-199321             ..................................................
AE016935.1/279858-279954             ..................................................
AE017178.1/187260-187147             ..................................................
AE017179.1/109208-109098             ..................................................
BX569689.1/134905-135013             ..................................................
BX572094.1/147473-147375             ..................................................
AE017166.1/115998-115896             ..................................................
BX572095.1/178356-178459             ..................................................
AE001887.1/9104-9203                 ..................................................
AE001862.1/178389-178274             ..................................................
X54035.1/52-153                      ..................................................
Z99112.2/3782-3883                   ..................................................
Z99119.2/164687-164788               ..................................................
U81371.1/247-152                     ..................................................
Z82044.1/19193-19300                 ..................................................
Z99110.2/31833-31941                 ..................................................
U64312.1/2271-2374                   ..................................................
AJ002571.1/43977-43865               G.................................................
M73546.1/221-329                     ..................................................
AE017026.1/171648-171751             ..................................................
AE016999.1/106602-106704             ..................................................
AE017025.1/103946-104055             ..................................................
AE016999.1/97492-97606               ..................................................
AE017013.1/198598-198699             ..................................................
AE017000.1/120837-120948             ..................................................
AE017000.1/121009-121112             ..................................................
AE017025.1/109350-109452             ..................................................
AE017006.1/104897-105002             ..................................................
AE017040.1/281858-281743             ..................................................
AE017281.1/27688-27573               ..................................................
AE017265.1/213026-213137             ..................................................
AE017265.1/218427-218529             ..................................................
AE017279.1/252135-252236             ..................................................
AE017266.1/253092-253204             ..................................................
AE017272.1/195611-195716             ..................................................
AE017266.1/253265-253367             ..................................................
AF104225.1/570-680                   U.................................................
AL596168.1/251336-251226             U.................................................
AL596164.1/123476-123581             ..................................................
AE016744.1/250277-250176             ..................................................
AF269570.1/1830-1729                 ..................................................
AF269819.1/1816-1718                 ..................................................
AE016746.1/165122-165020             ..................................................
AE016745.1/27312-27213               ..................................................
AE016750.1/293855-293964             ..................................................
AF109218.1/4405-4502                 ..................................................
AE015938.1/273488-273596             ..................................................
AE007806.1/8808-8702                 ..................................................
AE007651.1/7649-7751                 ..................................................
AE007789.1/9122-9015                 ..................................................
AE007798.1/8173-8025                 ..................................................
AE015942.1/58651-58542               ..................................................
AE007789.1/11572-11662               ..................................................
AE015936.1/222874-222760             CA................................................
AE013167.1/14408-14306               ..................................................
AE013192.1/4947-4844                 ..................................................
AE013112.1/9358-9256                 ..................................................
AE013127.1/3291-3189                 ..................................................
AE016955.1/241328-241238             ..................................................
AE016955.1/248631-248543             ..................................................
AE017200.1/98337-98247               ..................................................
AL935252.1/202700-202607             ..................................................
AL935252.1/99249-99354               ..................................................
AF159589.1/4059-4150                 ..................................................
AE006268.1/10610-10511               ..................................................
AE008441.1/13586-13488               ..................................................
AB042239.3/9807-9660                 GUAAAUUCCAUAACAUUGGAGUUUUGCGCAAAGUCUGG............
AE008564.1/13544-13464               ..................................................
AE014229.1/2499-2401                 ..................................................
AE008441.1/6797-6885                 ..................................................
AL766847.1/94269-94358               ..................................................
AE014913.1/8949-8849                 ..................................................
AE007380.1/3446-3534                 ..................................................
AE008441.1/3915-4003                 ..................................................
AE014230.1/102-191                   ..................................................
AE010000.1/5636-5540                 ..................................................
AE007508.1/3048-2943                 ..................................................
AE016968.1/6411-6516                 ..................................................
BX842644.1/215451-215359             ..................................................
M37339.1/618-707                     ..................................................
AL445564.1/265255-265358             ..................................................
AL445563.1/260054-259948             ..................................................
AE005876.1/3727-3622                 ..................................................
BX572604.1/199848-199986             UUCGCUCCGCGAGGCACAGAGA............................
AE009471.1/6144-5974                 CCAGCAAAAGCGUGAAACGGUUUUGCAUCAGGAAAUACUUGAAAACUG..
AE009607.1/63-169                    ..................................................
AL672115.1/15647-15763               ..................................................
AE009258.1/7675-7777                 ..................................................
AE008184.1/8540-8430                 ..................................................
AE009203.1/4053-3942                 ..................................................
AF004408.1/427-558                   GCUUUGCCUGUUGUG...................................
AY316746.1/2276-2378                 ..................................................
AF070520.1/2088-2190                 ..................................................
AL591793.1/152515-152628             ..................................................
AE017257.1/202839-202737             ..................................................
BX640423.1/313922-313811             ..................................................
AL646057.1/132458-132357             ..................................................
AE016921.1/114001-113907             ..................................................
AE016910.1/243048-243195             ..................................................
AL162752.2/339009-338906             ..................................................
AL162753.2/24984-25083               ..................................................
BX321856.1/50120-50227               ..................................................
BX842649.1/277414-277318             ..................................................
AL139075.2/104313-104417             ..................................................
AE001547.1/1336-1446                 ..................................................
AE000633.1/3712-3819                 ..................................................
M16495.1/2120-2233                   ..................................................
AE015710.1/12073-11979               ..................................................
AE015685.1/10697-10614               ..................................................
S54369.1/6984-7152                   ..................................................
AY123045.1/16666-16547               GCG...............................................
AF264948.1/14680-14561               GCG...............................................
AE016755.1/79951-79852               ..................................................
D10483.2/75274-75175                 ..................................................
AE016763.1/55154-55058               ..................................................
BX571860.1/177712-177587             ..................................................
BX571861.1/7126-7022                 ..................................................
AL627279.1/105836-106061             ..................................................
AL627265.1/128216-128117             ..................................................
AE016836.1/195900-195996             ..................................................
AE016985.1/136499-136403             ..................................................
AE016978.1/72938-72839               ..................................................
AJ414158.1/174343-174468             ..................................................
AJ414154.1/26151-26047               ..................................................
AE013968.1/546-637                   ..................................................
U32725.1/470-558                     ..................................................
U32720.1/1366-1454                   ..................................................
AE017152.1/157588-157680             ..................................................
U32782.1/8310-8397                   ..................................................
AB087258.1/15478-15568               ..................................................
AE006074.1/48-140                    ..................................................
AE006165.1/9171-9068                 ..................................................
AE016785.1/288775-288889             ..................................................
AE016792.1/163969-163863             ..................................................
AE004910.1/5287-5151                 ..................................................
AE004209.1/3442-3690                 ..................................................
AE004097.1/4180-4278                 ..................................................
AE016800.1/67341-67243               ..................................................
AE012449.1/4930-4832                 ..................................................
AE011991.1/4930-4833                 ..................................................
AE004009.1/105-203                   ..................................................
AE012556.1/212138-212040             ..................................................
AE011282.1/7576-7478                 ..................................................
AE001747.1/6884-6993                 ..................................................
AB111809.1/311-481                   ..................................................
AF217503.1/595-688                   ..................................................
AB118748.1/319-422                   ..................................................
M33642.1/428-524                     ..................................................
AB033416.1/2076-2219                 ..................................................
AY007661.1/532-727                   ..................................................
AC084406.7/91434-91300               ..................................................
AK068703.1/2083-2217                 ..................................................
AK119882.1/1-98                      ..................................................
AK120238.1/2075-2184                 ..................................................
AF264021.1/2226-2360                 ..................................................
AC005496.3/78625-78498               ..................................................
#=GC SS_cons                         ..................................................

AL445064.1/126097-125991             ......................AUGGAUC.GA.UCCCUGGA....ACCUG
AL445066.1/239884-239777             ......................AUGGAUCGA...CCCCUGGA...ACCUG
BX248354.1/27456-27566               ........................GUGCAAGCA.CCGUUUGA...ACCUG
BX248356.1/234808-234920             .......................UUGGCCGAA...CCGUAGA...ACCUG
BX927152.1/148798-148691             .............................ACA..CCCGUUGA...ACCUG
BX248356.1/232868-232999             .......................GUCCCUGAA..CCGUUGA....ACCUG
AY102616.1/4667-4777                 .......................GCGCGAGCA..CCGUUUGA...ACCUG
AL583918.1/38806-38668               ......................CUACCCUUA...CCCUCCCAC..ACCUG
AL583918.1/33385-33496               ......................GGCCGUC.GA..CCGUAUGA...ACCUG
AE017241.1/138845-138735             ......................GGCCGUC.GA..CCGUACGA...ACCUG
AE017241.1/124587-124696             ......................CCGCCCUUA...CCGUCAC....ACCUG
BX842573.1/159140-159250             ......................CUGCCCUUA...CCGUCAC....ACCUG
BX842573.1/168419-168309             ......................GGCCGUC.GA..CCGUACGA...ACCUG
AD000014.1/41361-41472               ......................GGCCGUC.GA..CCGUACGA...ACCUG
AL939118.1/94624-94813               GAAGCGUCGACGGACGGAAGCCGCUGCGUCGA..CCGCCGA....ACCUG
AL939124.1/163164-163269             ......................GGCCGCA.GA..CCCUCCGA...ACCUG
AL939111.1/162719-162830             .......................GGCCUCCGA..CCGUACGA...ACCUG
AE016935.1/265475-265571             .............................AUA..CCCAUAGA...AUCUG
AE016928.1/199416-199321             .............................AUA..CCCUAGGA...ACCUG
AE016935.1/279858-279954             .............................AUA..CCCAUAGA...AUCUG
AE017178.1/187260-187147             .............................AAA..CCCUCAUC...ACCUG
AE017179.1/109208-109098             .............................AUA..CCCAUAG....ACCUG
BX569689.1/134905-135013             .............................ACA..CCCUCUGA...ACCUG
BX572094.1/147473-147375             .............................AUA..CCCUUCGA...ACCUG
AE017166.1/115998-115896             .............................ACA..CCCUCUGA...ACCUG
BX572095.1/178356-178459             .............................ACA..CCCUCCGA...ACCUG
AE001887.1/9104-9203                 .............................ACA..CCCCAGGA...ACCUG
AE001862.1/178389-178274             .......................CGGGCCUAA..CCCUAUGA...ACCUG
X54035.1/52-153                      ......................UCGUUC.UGA..CCCUUUGA...ACCUG
Z99112.2/3782-3883                   .......................UUGUCUCAA..CCCUUUUG...ACCUG
Z99119.2/164687-164788               .......................UCGUUCUGA..CCCUUUGA...ACCUG
U81371.1/247-152                     .............................AAA..CCUUUUGG...ACUUG
Z82044.1/19193-19300                 .......................GCUUCUUAA..CCCUUUGG...ACCUG
Z99110.2/31833-31941                 .......................ACUUUUAGA..CCCUCAUA...ACUUG
U64312.1/2271-2374                   ........................AGCCUCAA..CUCUUAAA...ACCUG
AJ002571.1/43977-43865               .......................CGCUUUGAU..CCCUUAUG...ACCCG
M73546.1/221-329                     .......................ACUUUUAGA..CCCUCAUA...ACUUG
AE017026.1/171648-171751             .......................AAUCCUUAA..CCCUUAUAAC.ACCUG
AE016999.1/106602-106704             ......................AAACAUC.GA..CCCUCA.....ACCUG
AE017025.1/103946-104055             ......................CGUCAU.UGA..CCAUUUGA...ACCUG
AE016999.1/97492-97606               ......................CGUCAU.UGA..CCAUUUGA...ACCUG
AE017013.1/198598-198699             ......................UCGUUCC.GA..CCCUUCGA...ACCUG
AE017000.1/120837-120948             .......................AGCCUUUGA..UCCUUUUUAUUACCUG
AE017000.1/121009-121112             .......................AAUCCUUAA..CCCUUACAAC.ACCUG
AE017025.1/109350-109452             ......................AAACAUC.GA..CCCUCA.....ACCUG
AE017006.1/104897-105002             .......................AUUUUGAGA..CUCUUAGU...ACCUG
AE017040.1/281858-281743             .......................ACUUCUUAA..CCCUUUGG...ACCUG
AE017281.1/27688-27573               .......................ACUUCUUAA..CCCUUUGG...ACCUG
AE017265.1/213026-213137             ......................CGUCAU.UGA..CCAUUUGA...ACCUG
AE017265.1/218427-218529             ......................AAACAUC.GA..CCCUCA.....ACCUG
AE017279.1/252135-252236             .......................UCGUUCCGA..CCCUUCGA...ACCUG
AE017266.1/253092-253204             ......................AGUCUUUGA...UCCUUUUUAUUACCUG
AE017272.1/195611-195716             .......................AAUUUGAGA..CUCUUAGU...ACCUG
AE017266.1/253265-253367             .......................AAUCCUUAA..CCCUUACAG..ACCUG
AF104225.1/570-680                   ......................GGAUUCUGA...CCCUUUGA...ACCUG
AL596168.1/251336-251226             ......................GGAUUCUGA..CCCUUUGA....ACCUG
AL596164.1/123476-123581             ......................GCUUUCUGA...CCCUUUGA...ACCUG
AE016744.1/250277-250176             .......................UACUUUCAA..CCCUUGA....ACCUG
AF269570.1/1830-1729                 .......................UACUUUCAA..CCCUUGA....ACCUG
AF269819.1/1816-1718                 ........................UAUUCAGA..CCCUUAUA...ACCUG
AE016746.1/165122-165020             .......................AACCUCAAA..CCCUUCGA...ACCUG
AE016745.1/27312-27213               .......................UCAUCCAAA..CCCUUUGA...ACCUG
AE016750.1/293855-293964             .......................ACUUUAUAA..UUCCUGGA...ACCUG
AF109218.1/4405-4502                 .........................GACUAGA..CCCUUAUA...ACCUG
AE015938.1/273488-273596             ......................UAUCUCUGA...CCCUCAUA...ACCUG
AE007806.1/8808-8702                 .......................GAACUUCGA..UCCAUAU....ACCUG
AE007651.1/7649-7751                 .......................AAACUUUAA..CCCUUUGA...ACCUG
AE007789.1/9122-9015                 ......................GAUUCCA.GA..CCCUCAUA...ACCUG
AE007798.1/8173-8025                 .........................AAUCCAA..CCCUUUGA...ACUUG
AE015942.1/58651-58542               .......................AUUCUUAGA..CCCUUUA....ACCUG
AE007789.1/11572-11662               .......................UCACGUUAA..CCCUUA.....ACCUG
AE015936.1/222874-222760             .......................AUUCAUUAA..CCCUUGU....ACCUG
AE013167.1/14408-14306               .......................CGUUCCCGA..CCCUUAGA...ACCUG
AE013192.1/4947-4844                 .......................AAUGCCGAA..CCCUUGGA...ACCUG
AE013112.1/9358-9256                 .......................CGUUCCCGA..CCCUUAGA...ACCUG
AE013127.1/3291-3189                 .......................CGUUCCCGA..CCCUUAGA...ACCUG
AE016955.1/241328-241238             ............................GAUA..CCCAUUGA...ACCUG
AE016955.1/248631-248543             .............................AUA..CCCAUGGA...ACCUG
AE017200.1/98337-98247               .............................AUA..CCCAUUGA...ACCUG
AL935252.1/202700-202607             .............................AUA..CCCAUUGA...ACCUG
AL935252.1/99249-99354               .......................AGUACCGAU..CCCUUUGA...ACCUG
AF159589.1/4059-4150                 ......................AAACCCGGA..CCCUUCGA....ACCUG
AE006268.1/10610-10511               .............................AUA..CCAUCUG....ACCUG
AE008441.1/13586-13488               .......................CUGUUAGAU..CCCUCUG....ACUCA
AB042239.3/9807-9660                 .......................GUGUCUAAA..CUCUUUGA...ACCUG
AE008564.1/13544-13464               ..............................GA..CCGC.......ACCUG
AE014229.1/2499-2401                 .......................UAUGCAAAA..UCCUCUA....ACCUG
AE008441.1/6797-6885                 ............................GAUA..CCCAUUGA...ACCUG
AL766847.1/94269-94358               .............................AUA..CCCAUUGA...ACUUG
AE014913.1/8949-8849                 ........................UUGCAAAA..UCCUAUGG...ACCUG
AE007380.1/3446-3534                 .............................AUA..CCCAUUGA...ACCUG
AE008441.1/3915-4003                 ............................GAUA..CCCAUUGA...ACCUG
AE014230.1/102-191                   .............................AUA..CCCAUUGA...ACUUG
AE010000.1/5636-5540                 ........................UUGCGAAA..UCCUGAGG...ACCUG
AE007508.1/3048-2943                 .......................AAACUUCGA..CCGC.......ACCUG
AE016968.1/6411-6516                 .............................ACA..CUCUUAUG...AGCUG
BX842644.1/215451-215359             .............................AUA..CCUAUU.....AGCAG
M37339.1/618-707                     .............................AUA..CUCUAUA....AGUUG
AL445564.1/265255-265358             .............................AAA..CUCUUG.....AGCUG
AL445563.1/260054-259948             .............................AAA..CUCUUU.....AGCUG
AE005876.1/3727-3622                 ......................ACGCCCUGA...CCCGUAGA...ACCUG
BX572604.1/199848-199986             ......................CCGCGGUGA...CCCUUUGA...ACCUG
AE009471.1/6144-5974                 .......................CCCGGCCAA..CCCGCUGA...ACCUG
AE009607.1/63-169                    .......................UCACGUCAA..CCCAUUGA...ACCUG
AL672115.1/15647-15763               ......................GCGCAGUGA...CCCGUUGA...ACCUG
AE009258.1/7675-7777                 .......................UGAACCGGA..CCCUUGA....ACCUG
AE008184.1/8540-8430                 ..........................UGCCAA..CCCGAAGA...ACCUG
AE009203.1/4053-3942                 ........................GCGCAGUGA.CCCGUUGA...ACCUG
AF004408.1/427-558                   .......................GCGCGGUGA..CCCGUUGA...ACCUG
AY316746.1/2276-2378                 .......................UGAGCCGGA..CCCUUGA....ACCUG
AF070520.1/2088-2190                 .......................UGAGCCGGA..CCCUUGA....ACCUG
AL591793.1/152515-152628             .........................GAGCCAA..CCCGCGGA...ACCUG
AE017257.1/202839-202737             .......................AAAGUACAA..CCCUUUGA...ACCUG
BX640423.1/313922-313811             .............................AGU..CCCUUCGU...ACCAG
AL646057.1/132458-132357             .............................AGU..CCCUUCGC...ACCCG
AE016921.1/114001-113907             .............................ACA..CCCUGAGA...ACCUG
AE016910.1/243048-243195             .............................AUA..CCCUUGGA...ACCUG
AL162752.2/339009-338906             ........................AAGCAGAA..UCCGUAGA...ACCUG
AL162753.2/24984-25083               .............................AUA..CCCUUUAC...ACCCG
BX321856.1/50120-50227               .............................AGU..CCCUUAAU...ACCUG
BX842649.1/277414-277318             .............................UAA..CCCUUUGA...ACCUG
AL139075.2/104313-104417             ......................AAGCUUA.GA..CCGA.......ACCGG
AE001547.1/1336-1446                 .............................AAA..CCCGUAGA...ACUUG
AE000633.1/3712-3819                 .............................AAA..CCCGUAGA...ACUUG
M16495.1/2120-2233                   ........................AUUCGGGA..UCCGUGGA...ACCUG
AE015710.1/12073-11979               ........................CAGACGAA..CCCUUAGA...ACCUG
AE015685.1/10697-10614               ..............................GA..UCCGUUGA...ACCUG
S54369.1/6984-7152                   .............................AGA..CCCUUCGA...ACCUG
AY123045.1/16666-16547               ......................GCUUAGC.GA..CCCUUAGA...ACCUG
AF264948.1/14680-14561               ......................GCUUAGC.GA..CCCUUAGA...ACCUG
AE016755.1/79951-79852               .............................AUA..CCCGUCGA...ACCUG
D10483.2/75274-75175                 .............................AUA..CCCGUCGA...ACCUG
AE016763.1/55154-55058               .............................AUA..CCCGUAUC...ACCUG
BX571860.1/177712-177587             ........................AUUCGGGA..UCCGCGGA...ACCUG
BX571861.1/7126-7022                 .............................AAA..CCCGCCGA...ACCUG
AL627279.1/105836-106061             ........................AUUCGGGA..UCCGCGGA...ACCUG
AL627265.1/128216-128117             .............................AUA..CCCGUCGA...ACCUG
AE016836.1/195900-195996             .............................AUA..CCCGUACC...ACCUG
AE016985.1/136499-136403             .............................AUA..CCCGUAUC...ACCUG
AE016978.1/72938-72839               .............................AUA..CCCGUCGA...ACCUG
AJ414158.1/174343-174468             ........................AUUCGGGA..UCCGCGGA...ACCUG
AJ414154.1/26151-26047               .............................UGA..CCCGUAUU...ACCUG
AE013968.1/546-637                   .............................AAA..CCCGUCGA...ACCUG
U32725.1/470-558                     ............................GAUA..CCCGUGA....ACCUG
U32720.1/1366-1454                   ............................GAUA..CCCGUGA....ACCUG
AE017152.1/157588-157680             .............................AUA..CCCAUAGA...ACCUG
U32782.1/8310-8397                   .............................AUA..CCCGUGA....ACCUG
AB087258.1/15478-15568               .............................AUA..CCCGUGA....ACCUG
AE006074.1/48-140                    ............................GAUA..CCCGUGA....ACCUG
AE006165.1/9171-9068                 ............................GAUA..CCCGUGA....ACCUG
AE016785.1/288775-288889             ......................GCGCGGU.GA..CCCUUCGA...ACCUG
AE016792.1/163969-163863             .......................GGUGCGGAU..CCCGUUGA...ACCUG
AE004910.1/5287-5151                 .......................GUUCCGGAU..CCCGUUGA...ACCUG
AE004209.1/3442-3690                 ........................UAGCGAGA..CCCGUUGA...ACCUG
AE004097.1/4180-4278                 ........................AUUCGGGA..UCCGUUGA...ACCUG
AE016800.1/67341-67243               ........................AUUCGGGA..UCCGUUGA...ACCUG
AE012449.1/4930-4832                 .............................AGU..CCCUUCGA...ACCUG
AE011991.1/4930-4833                 .............................AGU..CCCUUCGA...ACCUG
AE004009.1/105-203                   .............................ACA..CCCUUCGA...ACCUG
AE012556.1/212138-212040             .............................ACA..CCCUUCGA...ACCUG
AE011282.1/7576-7478                 .............................AGU..CCCC.GGA...ACCUG
AE001747.1/6884-6993                 .......................AGUCCUCGA..CCCCAAGA...ACCUG
AB111809.1/311-481                   .............................AUA..CGGUCAAA...ACUUG
AF217503.1/595-688                   .............................AUA..CGGCUAAA...ACUUG
AB118748.1/319-422                   .............................AUA..CUGUCAUA...ACUUG
M33642.1/428-524                     .............................AUA..C.GGCGAA...ACUUG
AB033416.1/2076-2219                 .............................AUA..CGGCAAA....ACUUG
AY007661.1/532-727                   .............................AUA..CCGGCGA....ACUUG
AC084406.7/91434-91300               .............................AGU..CCCUUUGA...ACCUG
AK068703.1/2083-2217                 .............................AGU..CCCUUUGA...ACCUG
AK119882.1/1-98                      .............................AUA..CCCGUACC...ACCUG
AK120238.1/2075-2184                 .............................AGU..CCCUUUGA...ACCUG
AF264021.1/2226-2360                 .............................AGU..CCCUUUGA...ACCUG
AC005496.3/78625-78498               .............................AGU..CCCUUUGA...ACCUG
#=GC SS_cons                         ........................>>>>>>....>>>>........<<<<

AL445064.1/126097-125991             A.UCCGGGUAAU...............................ACCGGCG
AL445066.1/239884-239777             A.UCCGGGUAAU...............................ACCGGCG
BX248354.1/27456-27566               ..UCUGGUUAAC...............................ACCAGCG
BX248356.1/234808-234920             A.UCUGGGUAAU...............................ACCAGCG
BX927152.1/148798-148691             C.UCUAGCUCGU...............................ACUAGCG
BX248356.1/232868-232999             A.UCCGGGUAAU...............................ACCGGCG
AY102616.1/4667-4777                 ..UCCGGUUAGC...............................ACCGGCG
AL583918.1/38806-38668               A.UCCGGGUCAU...............................GCCGGCG
AL583918.1/33385-33496               A..CCGGGUAAU...............................GCCGGCG
AE017241.1/138845-138735             A..CCGGGUAAU...............................GCCGGCG
AE017241.1/124587-124696             A.UCCGGAUCAU...............................GCCGGCG
BX842573.1/159140-159250             A.UCCGGAUCAU...............................GCCGGCG
BX842573.1/168419-168309             A..CCGGGUAAU...............................GCCGGCG
AD000014.1/41361-41472               A..CCGGGUAAU...............................GCCGGCG
AL939118.1/94624-94813               UUACCGGGUAAU...............................GCCGGCG
AL939124.1/163164-163269             G.CCCAGGUCAU...............................UCUGG.G
AL939111.1/162719-162830             A.UCCGGGUCAU...............................GCCGGCG
AE016935.1/265475-265571             A.ACCGGGUAAU...............................GCCGGCG
AE016928.1/199416-199321             A.GGCAGUUAGC...............................ACUGACG
AE016935.1/279858-279954             A.UCCGGGUAAU...............................GCCGGCG
AE017178.1/187260-187147             A.ACCGGAUAAU...............................ACCGGCG
AE017179.1/109208-109098             A.UCCGGAUAAU...............................ACCGGCG
BX569689.1/134905-135013             A.CCCGGGUCAU...............................GCCGGCG
BX572094.1/147473-147375             A.AACAGUUAAA...............................ACUGACG
AE017166.1/115998-115896             A.UUCGGUUUAU...............................ACCGUCG
BX572095.1/178356-178459             A.UACGGGUUGU...............................GCCGGCG
AE001887.1/9104-9203                 A.ACCGGGUCAU...............................UCCGGCG
AE001862.1/178389-178274             A.ACUGGUUAGC...............................ACCAGCG
X54035.1/52-153                      ..U.UAGUUAAC...............................GCUGGCG
Z99112.2/3782-3883                   A.UCUGGAUCAU...............................GCCAGCG
Z99119.2/164687-164788               ..U.UAGUUAAC...............................GCUGGCG
U81371.1/247-152                     A.UAUGGAUCAU...............................ACCAGCU
Z82044.1/19193-19300                 A.UCUGGUUCGU...............................ACCAGCG
Z99110.2/31833-31941                 A.ACAGGUUCAG...............................ACCUGCG
U64312.1/2271-2374                   A.UCUAGCUUGU...............................ACUAGCG
AJ002571.1/43977-43865               A.UCUGGAUAAU...............................ACCAGCG
M73546.1/221-329                     A.ACAGGUUCAG...............................ACCUGCG
AE017026.1/171648-171751             A.UCUAGGUAAU...............................ACUAGCG
AE016999.1/106602-106704             A.UCUGGAUAAU...............................GCCAGCG
AE017025.1/103946-104055             ..U.UGGAUAAU...............................GCCAGCG
AE016999.1/97492-97606               ..U.UGGAUAAU...............................GCCAGCG
AE017013.1/198598-198699             ...UUAGUUAAU...............................GCUAACG
AE017000.1/120837-120948             A.UCUAGAUUAU...............................GCUAGCG
AE017000.1/121009-121112             A.UCUAGGUAAU...............................ACUAGCG
AE017025.1/109350-109452             A.UCUGGAUAAU...............................GCCAGCG
AE017006.1/104897-105002             A.UCUGGUUAAU...............................GCCAGCG
AE017040.1/281858-281743             A.UCUGGCUCGU...............................ACCAGCG
AE017281.1/27688-27573               A.UCUGGCUCGU...............................ACCAGCG
AE017265.1/213026-213137             ..U.UGGAUAAU...............................GCCAGCG
AE017265.1/218427-218529             A.UCUGGAUAAU...............................GCCAGCG
AE017279.1/252135-252236             ...UUAGUUAAU...............................GCUAACG
AE017266.1/253092-253204             A.UCUAGAUUAU...............................GCUAGCG
AE017272.1/195611-195716             A.UCUGGUUAAU...............................GCCAGCG
AE017266.1/253265-253367             A.UCUAGGUAAU...............................ACUAGCG
AF104225.1/570-680                   U.UC..GUUAAU...............................ACGAGCG
AL596168.1/251336-251226             U.UC..GUUAAU...............................ACGAGCG
AL596164.1/123476-123581             ..U.UUGUUAGU...............................GCAAGCG
AE016744.1/250277-250176             ..U.UGGUUAGC...............................ACCGGCG
AF269570.1/1830-1729                 ..U.UGGUUAGC...............................ACCAGCG
AF269819.1/1816-1718                 A.UUUGGUUAAU...............................ACCAACG
AE016746.1/165122-165020             A.UCUAGCUAGUU..............................ACUAGCG
AE016745.1/27312-27213               A.ACUAGCUUAU...............................ACUAGCG
AE016750.1/293855-293964             A.UCCAGUUCAU...............................ACUGGCG
AF109218.1/4405-4502                 A.UUUGGUUCGU...............................ACCAACG
AE015938.1/273488-273596             A.UUUGGCUAAU...............................ACCAACG
AE007806.1/8808-8702                 A.UUUGGAUAAU...............................GCCAACG
AE007651.1/7649-7751                 A.UUCGGUUAAU...............................UCUGACG
AE007789.1/9122-9015                 A.UUUGGAUAAU...............................GCCAACG
AE007798.1/8173-8025                 A.UGUAGUUAAU...............................ACUACCG
AE015942.1/58651-58542               A.UCUGGAUAAU...............................GCCAGCG
AE007789.1/11572-11662               A.UCUGGAUAAU...............................ACCAGCG
AE015936.1/222874-222760             A.ACUAGAUAAU...............................UCUAGCG
AE013167.1/14408-14306               A.CCAGGGUAAU...............................GCCUGCG
AE013192.1/4947-4844                 A.UGAGGGUAAU...............................GCCUCCG
AE013112.1/9358-9256                 A.CCAGGGUAAU...............................GCCUGCG
AE013127.1/3291-3189                 A.CCAGGGUAAU...............................GCCUGCG
AE016955.1/241328-241238             A.UGCAGUUAGU...............................ACUGUCG
AE016955.1/248631-248543             A.AACAGUUAGG...............................ACUGGCG
AE017200.1/98337-98247               ..UUUGAUUAAU...............................AUCAGCG
AL935252.1/202700-202607             AAUCUGGACAAU...............................GCCAGCG
AL935252.1/99249-99354               ..U.AAGCUCAA...............................ACUUGCG
AF159589.1/4059-4150                 U.UC..GUUAAU...............................GCGAGCG
AE006268.1/10610-10511               A.UCUGGGUAAU...............................GCCAGCG
AE008441.1/13586-13488               A.UCUAGGUAAU...............................GCUAGCU
AB042239.3/9807-9660                 A.ACAAGGUAAU...............................GCUUGCG
AE008564.1/13544-13464               A.UCUGGGUAAU...............................GCCAGCG
AE014229.1/2499-2401                 A.UCUCGUUAGG...............................ACGAGCG
AE008441.1/6797-6885                 A.UACAGUUAAG...............................ACUGGCG
AL766847.1/94269-94358               A.UACAGUUAGU...............................ACUGUCG
AE014913.1/8949-8849                 A.UCUAGUUAAU...............................ACUAGCG
AE007380.1/3446-3534                 A.UACAGUUAAG...............................ACUGGCG
AE008441.1/3915-4003                 A.UACAGUUAAG...............................ACUGGCG
AE014230.1/102-191                   A.UGCAGUUAGU...............................ACUGUCG
AE010000.1/5636-5540                 A.UCUUGUUAGU...............................ACAAGCG
AE007508.1/3048-2943                 A.UCUGGGUAAU...............................GCCAGCG
AE016968.1/6411-6516                 A.UCUGGUUAAC...............................ACCAGCG
BX842644.1/215451-215359             A.UCAUGGUAAU...............................UCAUGCG
M37339.1/618-707                     A.UCUAGAUAAU...............................GCUAGCG
AL445564.1/265255-265358             A.UCUAAUUAAU...............................AUUAGCG
AL445563.1/260054-259948             A.UCUAAUUAAU...............................AUUAGCG
AE005876.1/3727-3622                 A.UCCGGGUCAU...............................GCCGGCG
BX572604.1/199848-199986             A.UCCGGGUCAU...............................GCCGGCG
AE009471.1/6144-5974                 A.UCCGGUUUGC...............................ACCGGCG
AE009607.1/63-169                    A.UCCGGGUAAU...............................ACCUGCG
AL672115.1/15647-15763               A.UCCAGUUCAU...............................ACUGGCG
AE009258.1/7675-7777                 A.UCCGGGUCAU...............................GCCGGCG
AE008184.1/8540-8430                 A.UCCGGUUCAU...............................ACCGGCG
AE009203.1/4053-3942                 A.UCCAGUUCAU...............................ACUGGCG
AF004408.1/427-558                   A.UCCAGUUCAU...............................ACUGGCG
AY316746.1/2276-2378                 A.UCCGGGUCAU...............................GCCGGCG
AF070520.1/2088-2190                 A.UCCGGGUCAU...............................GCCGGCG
AL591793.1/152515-152628             A.UCCGGCUCAU...............................ACCGGCG
AE017257.1/202839-202737             A.UAUUGUUAAA...............................GCAAGCG
BX640423.1/313922-313811             ..UACGGAUAAU...............................GCCGAUG
AL646057.1/132458-132357             A.UCCGGUUCGU...............................ACCGGCG
AE016921.1/114001-113907             A.UCUGGAUCAU...............................GCCAGCG
AE016910.1/243048-243195             A.CCCGGAUAAU...............................ACCGGCG
AL162752.2/339009-338906             ..UCGGGGUAAU...............................GCCUGCG
AL162753.2/24984-25083               A.UCGGGAUAAU...............................ACCUGCG
BX321856.1/50120-50227               A.UGCGGAUAAC...............................GCCGCCG
BX842649.1/277414-277318             A.UAGAGAUAAU...............................GCUCGCG
AL139075.2/104313-104417             A.UCUGGAUAAU...............................ACCAGCG
AE001547.1/1336-1446                 ..UCAAGGUAAU...............................UCUUGCG
AE000633.1/3712-3819                 ..UCAAGGUAAU...............................UCUUGCG
M16495.1/2120-2233                   A.UCAGGCUAGC...............................ACCUGCG
AE015710.1/12073-11979               A.UCCGGCUAAU...............................ACCGGCG
AE015685.1/10697-10614               A.UCAGGUUAAA...............................ACCUGCG
S54369.1/6984-7152                   A.UCCGGAUCAU...............................GCUGGCG
AY123045.1/16666-16547               A.CCCAGCUGAU...............................ACUGGCG
AF264948.1/14680-14561               A.CCCAGCUGAU...............................ACUGGCG
AE016755.1/79951-79852               A.UCCGGAUAAC...............................GCCGGCG
D10483.2/75274-75175                 A.UCCGGAUAAC...............................GCCGGCG
AE016763.1/55154-55058               A.UCUGGAUAAU...............................GCCAGCG
BX571860.1/177712-177587             A.UCGGGUUAAU...............................ACCCGCG
BX571861.1/7126-7022                 A.UCCGGCUAAU...............................ACCGGCG
AL627279.1/105836-106061             A.UCAGGUUAAU...............................ACCUGCG
AL627265.1/128216-128117             A.UCCGGAUAAU...............................GCCGGCG
AE016836.1/195900-195996             A.UCUGGAUAAU...............................GCCAGCG
AE016985.1/136499-136403             A.UCUGGAUAAU...............................GCCAGCG
AE016978.1/72938-72839               A.UCCGGAUAAC...............................GCCGGCG
AJ414158.1/174343-174468             A.UCGGGUUAAU...............................ACCCGCG
AJ414154.1/26151-26047               A.UCUGGAUUAU...............................GCCAGCG
AE013968.1/546-637                   A.UCCGGUUAAC...............................CCCGGCG
U32725.1/470-558                     A.AACAGUUAGC...............................ACUGACG
U32720.1/1366-1454                   A.AACAGUUAGC...............................ACUGACG
AE017152.1/157588-157680             A.UCUGAUUCGU...............................AUCAGCG
U32782.1/8310-8397                   A.AACAGUUAAU...............................ACUGACG
AB087258.1/15478-15568               A.UACAGUUAAU...............................ACUGACG
AE006074.1/48-140                    A.UGCAGUUAAU...............................ACUGACG
AE006165.1/9171-9068                 A.UACAGCUAAC...............................ACUGACG
AE016785.1/288775-288889             A.UCCGGAUCAU...............................GCCGGCG
AE016792.1/163969-163863             A.UCAGGUUAGC...............................GCCUGCG
AE004910.1/5287-5151                 A.UCGGGCUAGC.GUCCGGUUCCGCCUCGCGCGGACCGCAGCAACCCGCG
AE004209.1/3442-3690                 A.UUCAGUUAGG...............................ACUGACG
AE004097.1/4180-4278                 A.UCAGGUUAAU...............................ACCUGCG
AE016800.1/67341-67243               A.UCAGGUUAGA...............................ACCUGCG
AE012449.1/4930-4832                 A.UCCGGCUCAU...............................ACCGGCG
AE011991.1/4930-4833                 A.UCCGGCUGAU...............................ACCGGCG
AE004009.1/105-203                   A.UCCGGUUUAC...............................ACCGGCG
AE012556.1/212138-212040             A.UCCGGUUUAC...............................ACCGGCG
AE011282.1/7576-7478                 A.UCAGGAUAAG...............................ACCUGCG
AE001747.1/6884-6993                 A.UCCGGGUAAU...............................GCCGGCG
AB111809.1/311-481                   A.UCUGGAUAAU...............................ACCAGCG
AF217503.1/595-688                   A.UCUGGAUAAU...............................ACCAGCG
AB118748.1/319-422                   A.UCUAGAUAAU...............................ACUAGCG
M33642.1/428-524                     A.UCUGGAUAAU...............................ACCAGCG
AB033416.1/2076-2219                 A.UCUGGAUAAU...............................ACCAGCG
AY007661.1/532-727                   A.UCUGGAUAAU...............................ACCAGCG
AC084406.7/91434-91300               A.ACAGGAUAAU...............................GCCUGCG
AK068703.1/2083-2217                 A.ACAGGAUAAU...............................GCCUGCG
AK119882.1/1-98                      A.UCUGGAUAAU...............................GCCAGCG
AK120238.1/2075-2184                 A.ACAGGAUAAU...............................GCCUGCG
AF264021.1/2226-2360                 A.ACAGGAUAAU...............................GCCUGCG
AC005496.3/78625-78498               A.ACAGGGUAAU...............................GCCUGCG
#=GC SS_cons                         ...<<<<<...................................>>>>>..

AL445064.1/126097-125991             .GAGG..GA..AAUUAUGGAAAAAAAUAG
AL445066.1/239884-239777             .GAGG..GA..AUCGUAUGAUGAAUGAGA
BX248354.1/27456-27566               .AAGG..AA..GAGAGGAGCGCGAGCCUA
BX248356.1/234808-234920             AUAGG..AA...GACUUCAUACUGUGACU
BX927152.1/148798-148691             .AAGG..GA...UGGCCUUAACGUGGCUA
BX248356.1/232868-232999             AUAGG..AA...GAAUAAUGAACCGAUCG
AY102616.1/4667-4777                 .AAGG..AA..GAGAGGAAUGGUGCAAUG
AL583918.1/38806-38668               .AAGG..GA..GGUUCAAGAUGCCGUCAG
AL583918.1/33385-33496               .UAGG..GA..GAUGAAUAAUGACUGAAA
AE017241.1/138845-138735             .UAGG..GA...GAUGAAAAAUGACCGCA
AE017241.1/124587-124696             .AAGG..GA...GGCCGCGAAUGCCCUCG
BX842573.1/159140-159250             .AAGG..GA..GGUCAAGGAUGGCGUCCG
BX842573.1/168419-168309             .UAGG..GA...GUUGCAAAUGACCAUCA
AD000014.1/41361-41472               .UAGG..GA...GUUGCAAAUGACCAUCA
AL939118.1/94624-94813               .UAGG..GA...GUAGGUCUCAUGACCAU
AL939124.1/163164-163269             .UAGG..GA..GAUCGGUCACCACUCGAG
AL939111.1/162719-162830             .AAGG..GA...GGGGCUGGACGCCCAUG
AE016935.1/265475-265571             .UAGA..GA...ACUAAUUAAUAAGCAAG
AE016928.1/199416-199321             .UAGG..GA...UUGUGUUUCUUUCUUAU
AE016935.1/279858-279954             .UAGA..GA...ACGAAUAAAUAAGCAAA
AE017178.1/187260-187147             .UAGG..AA.ACUCUCCGUCUGACUAUCU
AE017179.1/109208-109098             .GAGG..GA..UGUAGAAUCGAAUACACA
BX569689.1/134905-135013             .AAGG..GA...AGUGACCAGCGUGAUCG
BX572094.1/147473-147375             .CAGG..AA...AGUUUCAAUUUGAUCGA
AE017166.1/115998-115896             .AAGG..AA...AGUGAAAGAGAGUGAUC
BX572095.1/178356-178459             .CAGG..GA...AGUGAAAUGACGUGAUC
AE001887.1/9104-9203                 .GAGG..GA..GUGUGAUGCUCUGCUCCG
AE001862.1/178389-178274             .GAGG..GA..GUGUGACGGGCGCAGAGA
X54035.1/52-153                      .UAGG..GA...UGUGGCAAAUGCAAUAG
Z99112.2/3782-3883                   .GAGG..GA...AGCGGUGAAAAGCGGAG
Z99119.2/164687-164788               .UAGG..GA...UGUGGCAAAGUCAAAUG
U81371.1/247-152                     .UAGG..AA..AGUAGUGUAAUUUUUUCC
Z82044.1/19193-19300                 .UGGG..GA...AGUAGAGGAAUUGUUUU
Z99110.2/31833-31941                 .UAGG..GA...AGUGGAGCGGUAUUUGU
U64312.1/2271-2374                   .UAGG..GA...AGUGGUGGCACAUUCUA
AJ002571.1/43977-43865               .UGGG..GA...AGUGCAGGUUGACCGAA
M73546.1/221-329                     .UAGG..GA...AGUGGAGCGUAUUUGUG
AE017026.1/171648-171751             .AAGG..GA...AGUGGAACAACGAAUAA
AE016999.1/106602-106704             .UAGG..GA..GUUACUUAAAGUGAUGUA
AE017025.1/103946-104055             .UAGG..GA..GAGUGUAAAAGCACAUGU
AE016999.1/97492-97606               .UAGG..GA.GAGUGUAAAAGCACAUAUU
AE017013.1/198598-198699             .CAGG..GA..UUGUGCAAACGUCCGAAA
AE017000.1/120837-120948             .UAGG..GA...AGCAAUUCGGACACUAA
AE017000.1/121009-121112             .AAGG..GA...AGUGGAACAUCGAAUAA
AE017025.1/109350-109452             .UAGG..GA..GUUACUUAAAGUAAUGUA
AE017006.1/104897-105002             .UAGG..GA...AGUGGGAAAGACGUUGC
AE017040.1/281858-281743             .UAGG..GA...AGUUAACGGCUUUACAU
AE017281.1/27688-27573               .UAGG..GA...AGUUAACGGCUUUACAU
AE017265.1/213026-213137             .UAGG..GA.GAGUGUAAAAGCACAUGUU
AE017265.1/218427-218529             .UAGG..GA..GUUACUUAAAGUGAUGUA
AE017279.1/252135-252236             .CAGG..GA..UUGUGCAAACGUCCGAAA
AE017266.1/253092-253204             .UAGG..GA...AGCAAUUCGGACACUAA
AE017272.1/195611-195716             .UAGG..GA...AGUGGGAAAGACAUUGC
AE017266.1/253265-253367             .AAGG..GA...AGUGGAGCAACGAAUAA
AF104225.1/570-680                   .UAGG..GA..UUGUGGCGAUUGCAUUUC
AL596168.1/251336-251226             .UAGG..GA..UUGUGGCGAUUGCAUUUC
AL596164.1/123476-123581             .UAGG..GA...AGUGAAUGUGAAAGUGA
AE016744.1/250277-250176             .UAGG..AA...AGUGAGCAAUAUUGAUA
AF269570.1/1830-1729                 .UAGG..AA...AGUGAGCAAUAUUGAUA
AF269819.1/1816-1718                 .UAGG..AA...AGUAGUUAUUAACUAUU
AE016746.1/165122-165020             .UAGG..AA...AGUGUUGUUAUACAUCU
AE016745.1/27312-27213               .GAGG..AA...AGUGUUGAAUCUCAUCU
AE016750.1/293855-293964             .UAGG..GA...AGUGGCGACGCUCAAUU
AF109218.1/4405-4502                 .UAGG..AA...AGUAGUAUAUUCAGAAU
AE015938.1/273488-273596             .UAGG..GA...ACAUUGUGUAUUGUAGU
AE007806.1/8808-8702                 .UAGG..AA...AUAGGUUACUUGAUUUA
AE007651.1/7649-7751                 .AAGG..AA...AGCUUUUUAAAUGAUUA
AE007789.1/9122-9015                 .UAGG..GA..GUUAAUGCAUCAUGUUUG
AE007798.1/8173-8025                 .UAGG..GA...AGCAGUGCAUUGUAUAU
AE015942.1/58651-58542               .UAGG..GA...GAUGGUUUACUAUAUAA
AE007789.1/11572-11662               .UAGG..GA...AGCAGUU..........
AE015936.1/222874-222760             .UAGG..GA...AGCCUUUUAUAGAUAUA
AE013167.1/14408-14306               .AAGG..GA...AGCACGUUUUACGGAAU
AE013192.1/4947-4844                 .UAGG..GA..AUGCGGGCUCAAAAGGCA
AE013112.1/9358-9256                 .AAGG..GA...AGCACGUUUUACGAAAU
AE013127.1/3291-3189                 .AAGG..GA...AGCACGUUUUAUUGAGU
AE016955.1/241328-241238             .CAGG..GA...AAUGCCGAUUUACUUUG
AE016955.1/248631-248543             .CAGG..GA...AAUGUCUUGAAAUUUUG
AE017200.1/98337-98247               .UAGG..GA..AAAUGACUAUUUUUAGAC
AL935252.1/202700-202607             .CAGG..GA.GCAAUGCUUUUAUUUGGGG
AL935252.1/99249-99354               .UAGG..AA...AGUGUCACAGCUAAUGU
AF159589.1/4059-4150                 .UAGG..GA..UUUGUGAAUGGU......
AE006268.1/10610-10511               .UAGG..AA...UGUGUUAAGACAAAUGU
AE008441.1/13586-13488               .GAUG..GA...AGUGGAAAUGAUAAUGG
AB042239.3/9807-9660                 UAAGG..GA...UGUGCAGAAAUAAGUGG
AE008564.1/13544-13464               .GAGG..GA..ACGAUACUUAGUCUAAUU
AE014229.1/2499-2401                 .UAGG..AA...UUGUGGUUUGAAUUGGU
AE008441.1/6797-6885                 .AAGG..GA...AAUGUGAAAUGUUUUUU
AL766847.1/94269-94358               .AAGG..GA...AAUGUGUGCCAUUACAA
AE014913.1/8949-8849                 .UGGG..AA...UGUGAUUCGUUUCAUGA
AE007380.1/3446-3534                 .AAGG..GA...AAUGUGAACAGUUUUUU
AE008441.1/3915-4003                 .AAGG..GA...AAUGUGAAACGUUUUUU
AE014230.1/102-191                   .AAGG..GA...AAUGUGUGCCAUUACAA
AE010000.1/5636-5540                 .UAGG..GA...UUGUGACCAAUAAUCAA
AE007508.1/3048-2943                 .GAGG..GAACGAUACUUAGUCUAAUUUU
AE016968.1/6411-6516                 .UAGC..GA...GUUAUAUCUCUCACAAG
BX842644.1/215451-215359             .UGGCUAAA..GAUUUUUUACAGGUUAUG
M37339.1/618-707                     .UAAC..GA...GUUGUUUUUUAUUUUCA
AL445564.1/265255-265358             .UAGC..GA...GUCUUUGGUAAAAUAAU
AL445563.1/260054-259948             .UAGC..GA...GACUUUAAAUUUCGUCU
AE005876.1/3727-3622                 .AAGG..GA...GGGAACGCGGACGACAG
BX572604.1/199848-199986             .AAGG..GA..CAGGGAUGCAUCAGACAG
AE009471.1/6144-5974                 .GAGG..GA...UUAGACGCUCGAUGAAC
AE009607.1/63-169                    .UAGG..GA...ACGGAGUUUGGCGCGUC
AL672115.1/15647-15763               .UAGG..GA..CGGUGCAAGCGCUUUGCG
AE009258.1/7675-7777                 .UAGG..AA...CGGAACUGUCGUGCGCU
AE008184.1/8540-8430                 .GAGG..GA...UUAGACGGCUUAAAGGC
AE009203.1/4053-3942                 .UAGG..GA..CGGUGCAAAGACCUGAUG
AF004408.1/427-558                   .UAGG..GA..CGGUGCGGACCUGCGGCU
AY316746.1/2276-2378                 .UAGG..AA...CGGAACGAGGCUGCCCU
AF070520.1/2088-2190                 .UAGG..AA...CGGAAAGAAGGCCGCCA
AL591793.1/152515-152628             .GAGG..GA...UUAGAAGCGAUCGGACC
AE017257.1/202839-202737             .UAGG..GA...AAUAUAUGUAUAUAAAU
BX640423.1/313922-313811             .CUGG..GA...GCGUAUUCCAGUUGCCG
AL646057.1/132458-132357             .UGGG..AA...GUUUCUUCAGAACACCG
AE016921.1/114001-113907             .GAGG..GA..GCGUGAUGAAGCGGAAUC
AE016910.1/243048-243195             .UAGG..GA...AGCGUCACCUGCCCGCC
AL162752.2/339009-338906             .UAGG..AA...ACAAACCGUCAAAUGCC
AL162753.2/24984-25083               .UGGG..GA...GUUUUCACGGAUUCUGC
BX321856.1/50120-50227               .GAGG..GA...AGCCAGGAGUCACUCUC
BX842649.1/277414-277318             .CAGG..GA...AGCAAGAAUAGAAAGAU
AL139075.2/104313-104417             .UCGG..GA..AGAUUUAUAAAUUUCAAU
AE001547.1/1336-1446                 .UAAG..GA..AUAACAUGUUAAUAACCA
AE000633.1/3712-3819                 .UAAG..GA..A.AUAGCAUGUUAAUAAC
M16495.1/2120-2233                   .AAGG..GA..AACAAGGGUAACUUGCGG
AE015710.1/12073-11979               .UAGG..AA...UGGGCCAAUCAACAGCA
AE015685.1/10697-10614               .AAGG..AA...ACAAGCAUAAUAACUUC
S54369.1/6984-7152                   .CAGG..AA...AGCAGGCAAGACAGAGG
AY123045.1/16666-16547               .UAGG..AA...GACUCGUAUCUUGAUGA
AF264948.1/14680-14561               .UAGG..AA...GACUCGUAUCUUGAUAA
AE016755.1/79951-79852               .AAGG..GA..UUUGAGGCUCCUUCUCAA
D10483.2/75274-75175                 .AAGG..GA..UUUGAGGCUCCUUCUCAA
AE016763.1/55154-55058               .UAGG..GA...AGUCACGGACCACCAGG
BX571860.1/177712-177587             .AAGG..GA...ACAAGAGUAAUCAACCG
BX571861.1/7126-7022                 .UAGG..GA..UUUGAGCUGCUAACUAUU
AL627279.1/105836-106061             .AAGG..GA...ACAAGAGUAAUUCUGCU
AL627265.1/128216-128117             .AAGG..GA..UUUGAGGCUACCUCUCAA
AE016836.1/195900-195996             .UAGG..GA...AGUCUGACACUGCUCGU
AE016985.1/136499-136403             .UAGG..GA...AGUCACGGACCACCAGG
AE016978.1/72938-72839               .AAGG..GA..UUUGAGGCUCCUUCUCAA
AJ414158.1/174343-174468             .AAGG..GA...ACAAGAGUAAUUUAUCG
AJ414154.1/26151-26047               .UAGG..GA...AGUCUCGGCACCGUAGG
AE013968.1/546-637                   .GAGG..GA...UUUGAGAAUGAUAACGA
U32725.1/470-558                     .UAGG..AA...ACUAAUAUGCCACAUAU
U32720.1/1366-1454                   .UAGG..AA...ACUAAUAUGCCAAAAAA
AE017152.1/157588-157680             .UAGG..GA..UUUGAGGCCAUUUCUACU
U32782.1/8310-8397                   .UAGG..AA...ACUAGGAAUAUAACCUU
AB087258.1/15478-15568               .UAGG..AA...ACUAAUGGUCUUACUCC
AE006074.1/48-140                    .UAGG..AA...ACUAGCAGUCAAUAUUG
AE006165.1/9171-9068                 .UAGG..AA...ACUAAUUAUGCCAAUAA
AE016785.1/288775-288889             .AAGG..GA...UGGGGCUUGUAACCUGC
AE016792.1/163969-163863             .UAGG..GA...ACAAGAUUGCUCGCCUU
AE004910.1/5287-5151                 .UAGG..GA...ACAAGAUGUCCGCGCCA
AE004209.1/3442-3690                 .UAGG..GA...ACUAUCCUCAACCGCUG
AE004097.1/4180-4278                 .AAGG..GA...ACAAGAGAAGACUCUCU
AE016800.1/67341-67243               .AAGG..GA...ACAAGAGAAGAUACUUG
AE012449.1/4930-4832                 .UAGG..GA..AGCUUCGUUAGAUGCGCU
AE011991.1/4930-4833                 .UAGG..GA..AGCUUCGUCAGAUGCGAU
AE004009.1/105-203                   .UAGG..AA..AGCUUCGUGGACCGCGCC
AE012556.1/212138-212040             .UAGG..AA..AGCUUCGUGGACCGCGCC
AE011282.1/7576-7478                 .UAGG..AA...AACGGACCUGUAAAAUU
AE001747.1/6884-6993                 .GAGG..GA...UCGGGGAAGGAGGAAAU
AB111809.1/311-481                   .AAAG..GA..UCAUGCCUUCCCUUGCCU
AF217503.1/595-688                   AAAAG..GG..UCAUGCCUUCUCUCGUUC
AB118748.1/319-422                   .AAAG..GA...CAUGCGUGGCAUUGAUU
M33642.1/428-524                     .AAAG..GA...UCAUGCUCUCCUCCCCC
AB033416.1/2076-2219                 .AAAG..GA...UCAUGUCAUCUCCCCUA
AY007661.1/532-727                   .AAAG..GA..UUGGCUUCUUGGGACCCC
AC084406.7/91434-91300               .AAGG..GA..GUGUGCAUUUCUACUUUU
AK068703.1/2083-2217                 .AAGG..GA..GUGUGCAUUUCUACUUUU
AK119882.1/1-98                      .UAGG..GA...AGUCAGAUGCCUGCCCG
AK120238.1/2075-2184                 .AAGG..GA..GUGUGCAUUUCUACUUUU
AF264021.1/2226-2360                 .UAGG..GA..GUGUGCAUUUCUAUUUUG
AC005496.3/78625-78498               .CAGG..GA..GUGUGCAGUUUUUUUUUU
#=GC SS_cons                         .>>>>.......>>>>>............
//

Department of Computer Science and Information Engineering, National Central University, Tao-yuan, Taiwan
Contact with site administrator:
Tzu-Hao Chang