RNALogo - a new approach to display structural RNA alignment
Home CreateLogo Gallery Documentation Help

► The RNALogo of RF00080 family:
 


See detail values
See the detail description of RF00080 in Rfam
 

► The SequenceLogo of RF00080 family:

► Reset display of RNALogo of RF00080 family:
 Family sequences selection : Seed ( 50 seqs.) Full ( 142 seqs.)
 Output image format :  
 Output image size :   x pixel

 


► The sequences in RF00080 family:
# STOCKHOLM 1.0

#=GF AC   RF00080
#=GF ID   yybP-ykoY
#=GF DE   yybP-ykoY leader
#=GF PI   SraF;
#=GF AU   Moxon SJ
#=GF SE   Barrick JE, Breaker RR
#=GF SS   Predicted; Barrick JE, Breaker RR
#=GF GA   40.00
#=GF TC   40.11
#=GF NC   39.57
#=GF TP   Cis-reg;
#=GF BM   cmbuild CM SEED
#=GF BM   cmsearch -W 200 CM SEQDB
#=GF RN   [1]
#=GF RM   11448770
#=GF RT   Novel small RNA-encoding genes in the intergenic regions of
#=GF RT   Escherichia coli.
#=GF RA   Argaman L, Hershberg R, Vogel J, Bejerano G, Wagner EG, Margalit H,
#=GF RA   Altuvia S;
#=GF RL   Curr Biol 2001;11:941-950.
#=GF RN   [2]
#=GF RM   15096624
#=GF RT   New RNA motifs suggest an expanded scope for riboswitches in
#=GF RT   bacterial genetic control.
#=GF RA   Barrick JE, Corbino KA, Winkler WC, Nahvi A, Mandal M, Collins J, Lee
#=GF RA   M, Roth A, Sudarsan N, Jona I, Wickiser JK, Breaker RR;
#=GF RL   Proc Natl Acad Sci U S A 2004;101:6421-6426.
#=GF CC   This RNA was originally discovered in E. coli during a large scale screen
#=GF CC   and was named SraF [1]. The family was later found to exist upstream of
#=GF CC   related families of protein genes in many bacteria, including the the yybP
#=GF CC   and ykoK genes in B. subtilis. The specific functions of these proteins are
#=GF CC   unknown, but this structured RNA element may be involved in their genetic
#=GF CC   regulation as a riboswitch [2].
#=GF SQ   50

BX927153.1/297716-297548             UCCCGUAUUGGAGGGGAGUACCCC...................ACAAG..
BX248358.1/90582-90421               ACUGUAGUUGGAGGGGAGUACCCC.......A...........CCCAC..
BX842584.1/155440-155547             GACGUUAGCGAAGGGGAGUAGUCC...................CGAA...
AL939112.1/94442-94322               GACGGCGCAGAAGGGGAGUAGCU....................CUUCG..
Z99124.2/158222-158117               GAACACUCCAAAGGGGAGUAGCU....................UUCAC..
Z99110.2/200192-200316               UGAAAUCCCAAAGGGGAGUAGCG..UCCGGAAU..........GUAU...
AF325827.1/1344-1451                 AAACUUCCUAAAGGGGAGUAGCU....................UUAAC..
AF109909.2/85-201                    UUACGGAGUAAAGGGGAGUAGCG..UCAGG.............GAAA...
AE017028.1/108421-108293             CAUAUCUCCAAAGGGGAGUAGCG..UCCAAGAA..........UAUUU..
AE017002.1/74863-74734               CAUAUCUCCAAAGGGGAGUAGCG..UCCAAGAA..........UAUUU..
AE017267.1/64114-64220               UGUGUAUAUAAAGGGGAGUAACUU...................AUUAC..
AL591977.1/131463-131588             ACAAAUGUCAGAGGGGAGUAGCG..CUGAUUAG..........CUUUU..
AL596167.1/48063-48187               ACAAAUGUCAGAGGGGAGUAGCG..CUGAUUAG..........CUUUU..
AF270169.1/2621-2476                 AAAACUGUCAGAGGGGAGUAACUU.GAGAAUA...........GUUAUUG
AE016746.1/110388-110533             AAAACUGUCAGAGGGGAGUAACUU.GAGAAUA...........GUUAUUG
Y14370.1/1315-1188                   CAUUUUGUCAGAGGGGAGUAACUU.AAGAAUCAUGACCG....UAUAA..
AE015938.1/76711-76816               UUACUAUAUAAAGGGGAGUAGCAA.A.................UUAAU..
AE012978.1/1-99                      UCU..CGGUAAAGGGGAGUAACUC...................UAAAU..
AE012997.1/6989-7110                 AACAUAAGUAAAGGGGAGUAGCUU..GCCACA...........GUAU...
AE016953.1/48442-48336               AGUUUUUUCAUGAGGGAGUAACUG.ACAGUA............UUUA...
AE017205.1/106071-105970             UAUAGAUGCAUAAGAGAGUAACG..GCAA..............GUUA...
AL935253.1/180146-180248             GAUACAAUCAUAAGGGAGUAACUA.GCAGAA.............AUA...
AE014915.1/3159-3261                 UGAAGAUUAUCAAGGGAGUAGCUA.GCGG..............UUUUG..
AE010002.1/2251-2354                 GUUAUUAUAUCAAGGGAGUAGCAG.ACGG..............CUAG...
AE014215.1/8470-8571                 AUUAACAUAUCAAGGGAGUAGCAG.ACGG..............UUUA...
AE007449.1/12778-12662               UGGUACUACUCAAGGGAGUAGCUG.GCAG...............AAAC..
AE005906.1/7630-7499                 CCGCCCACCUUUGGGGAGUAGCCG.CCCGCGU...........CUAUC..
AL646068.1/58739-58896               CCGGCUUCCAUUGGGGAGUAGCC.GCCUGGAG...........CCAAU..
AL646061.1/184783-184648             GACUUCCUCAAAGGGGAGUAGCUC.GGGGGUU...........CUUCA..
BX321864.1/302773-302659             UUGCCGGUCAUUGGGGAGUAGCCG.CUCUUC............GUUUC..
AE015551.1/8187-8055                 CAUCUCGCUUCGGGGGAGUAGCUA.ACUGGAUUUCGAG.....CCAUC..
U18997.1/19117-19256                 GUUACCUGCAAAGGGGAGUAACUU...................CAUUG..
AE016761.1/247677-247799             GCGCCCUCAUUUGGGGAGUAGCCG.AUUUCCAG..........AUUCC..
D90826.1/6621-6743                   GCGCCCUCAUUUGGGGAGUAGCCG.AUUUCCAG..........AUUCC..
BX571872.1/163681-163547             CACCGCAGCAAAGGGGAGUAACUU.C.................CUUA...
AE008781.1/18002-18124               GCGCCGUCAAUUGGGGAGUAGCCG.AUUUCCAG..........ACUCC..
AE008848.1/13783-13922               GUUACGCGCAAAGGGGAGUAACUU...................CAUUG..
AE016837.1/226247-226125             GCGCCGUCAAUUAGGGAGUAGCCG.AUUUCCAG..........ACUCC..
AE013857.1/9631-9778                 UGCGCCGUUCAUGGGGAGUAGCCG.GUUUCUGUGCAAUAUAUUCAUAA..
AE016776.1/272500-272339             CGCACCGUCCUAGGGGAGUAGUCU.CCCGCGAGCAC.......CCAGC..
AE004877.1/3967-4112                 CGCCCCGUCCUAGGGGAGUAGUCU.CCCGCGAGCGC.......CGCAC..
AE004717.1/4063-3947                 CCGGCCUUCCUUGGGGAGUAGCCU.GCCGUCA...........CCCGU..
AE016809.1/257790-257673             UAGCGCCGCUUAAGGGAGUAGCCU.UCCUCAU...........GGUU...
AE004385.1/7550-7674                 UGGCGACGUUUUGGGGAGUAGUCG..C................CUUAG..
AE004094.1/6414-6545                 CGCUCCGUCUUUGGGGAGUAGCUG.GUCUCUAAG.........UUUUC..
AE012529.1/9465-9584                 GCGCGCCCCCUUGGGGAGUAGCCU.GCUUCCA...........GUCGA..
AE012090.1/10837-10947               UCGGGCGCAGAAGGGGAGUAGCUC...................CCAG...
AE012550.1/9704-9824                 UCGGCCGCAGAAGGGGAGUAGCUC...................CCAG...
AE012070.1/1125-1243                 UGCGCGCCCCUUGGGGAGUAGCCU.GCUUUCG...........UCAUC..
AE012558.1/14966-15083               UGCCUUCCCCUUGGGGAGUAGCCU.GCUUCCA...........CACAU..
#=GC SS_cons                         .....<<<<<<<<<......<<<<.<<<<<<...................

BX927153.1/297716-297548             ..............................CAGCGUUGAUUCGUCAAC.A
BX248358.1/90582-90421               ..............................GGCAUUGA..UCGUCAAC.A
BX842584.1/155440-155547             ..............................UCGUCGAG..UCGACAUA.C
AL939112.1/94442-94322               ..............................CCGGACCG..UCGACAUA.C
Z99124.2/158222-158117               ..............................AGUAA.AG..UCGUCAUU.A
Z99110.2/200192-200316               ........................UCCGGAAACAA.AG..UCGUCAUU.U
AF325827.1/1344-1451                 ..............................AGCAA.AG..UCGUCAUU.A
AF109909.2/85-201                    .........................CCUGAAACAA.AG..UCGUCAUU.A
AE017028.1/108421-108293             ........................CUUGGAAACAA.AG..UCGUCAUU.A
AE017002.1/74863-74734               ........................CUUGGAAACAA.AG..UCGUCAUU.A
AE017267.1/64114-64220               ..............................AGUAA.AG..UCGUCAUU.A
AL591977.1/131463-131588             .......................UAAUCAGGAUAA.AG..UCGUCAUU.A
AL596167.1/48063-48187               ........................AAUCAGGAUAA.AG..UCGUCAUU.A
AF270169.1/2621-2476                 AAUGCAUUUAAACCGAUAAUAACUAUUCAACACUU.UG..UCGUCAUU.A
AE016746.1/110388-110533             AAUGCAUUUAAACUGAUAAUAACUAUUCAACACUU.UG..UCGUCAUU.A
Y14370.1/1315-1188                   .....................AUGAUUCGACACUU.UA..UCGUCAUU.A
AE015938.1/76711-76816               .............................UUAACU.AU..UCGUCAUU.A
AE012978.1/1-99                      ..............................CAAUC.AG..UCGUCAUG.A
AE012997.1/6989-7110                 ........................GUGGUUUAACC.UG..UCGUCAGC.A
AE016953.1/48442-48336               ........................UGCUGUGACAA.CA..UCACCAACUC
AE017205.1/106071-105970             ..........................UUGCGAUAA.GU..UCAACA.A.C
AL935253.1/180146-180248             ........................UUCUGCGGCAA.UA..UCGUCAGC.A
AE014915.1/3159-3261                 ..........................CCGUGAUGU.UG..UCGUCAAU.C
AE010002.1/2251-2354                 ..........................CCGUGAUUG.UA..UCGUCAAU.A
AE014215.1/8470-8571                 ..........................CCGUGGCAA.UG..UCGUCAUU.A
AE007449.1/12778-12662               ..........................CUGUGAUAG.UG..UCGUCAUU.C
AE005906.1/7630-7499                 ........................AGCGGGCCCCGCCG..UCAACACA.C
AL646068.1/58739-58896               ......................GCUCCGGGGGCCA.CG..UCAACAGA.C
AL646061.1/184783-184648             ........................GCCCCAGGCAC.GA..UCGUCAUG.A
BX321864.1/302773-302659             ........................GAAGGGGCUUA.CG..UCAACAUA.C
AE015551.1/8187-8055                 ....................GAUCUCUAGGGUGAA.CG..UCAACAUA.C
U18997.1/19117-19256                 ..............................CCGGUCGA..UCGUCAUU.A
AE016761.1/247677-247799             ........................GGAAAUGUACG.UG..UCAACAUA.C
D90826.1/6621-6743                   ........................GGAAAUGUACG.UG..UCAACAUA.C
BX571872.1/163681-163547             .............................GCCGGUUUA..UCGUCAUU.A
AE008781.1/18002-18124               ........................GGAAAUGUACG.UG..UCAACAUA.C
AE008848.1/13783-13922               ..............................CCGGUCGA..UCGUCAUU.A
AE016837.1/226247-226125             ........................GGAAAUGUACG.UG..UCAACAUA.C
AE013857.1/9631-9778                 ...........UAUAUUGGCAAGCAGAAACGCCCG.UA..UCAACAUA.C
AE016776.1/272500-272339             .......................UCGCCCGGUACG.CG..UCAACAUA.C
AE004877.1/3967-4112                 ..................CGGCCUCGCCCGGCACG.CG..UCAACACA.C
AE004717.1/4063-3947                 .......................UGACGGCGCGCU.GG..UCAACAUU.C
AE016809.1/257790-257673             ........................UGAGGAGUGAA.UA..UCAACAGUCU
AE004385.1/7550-7674                 ............................GUUUAUU.UG..UCGUCAUC.A
AE004094.1/6414-6545                 ...................AACUUGGUGAUUCACA.CA..UCAACAUA.U
AE012529.1/9465-9584                 .......................UGGAAGCGCCCG.CA..UCAACAUA.C
AE012090.1/10837-10947               ..............................CGUUGUCG..CCGUCAUG.A
AE012550.1/9704-9824                 ..............................CGUUGUCG..CCGUCAUU.A
AE012070.1/1125-1243                 ........................GAAAGCGCCUG.CA..UCAACAUA.C
AE012558.1/14966-15083               ......................CUGGAAGCGCUCG.CG..UCAACACA.C
#=GC SS_cons                         ........................>>>>>><<<<<.<<..<<<.......

BX927153.1/297716-297548             CGGAAAUCAAACUUUAAAGAAUUUUAGGUUGUGAAUUCCCGGUCACACUG
BX248358.1/90582-90421               CGGUUACCAUGCGAGAAU........UCUCGUACGAUCCCGG.UCAUGUC
BX842584.1/155440-155547             UGGC..........GAAA...............A..GCCCGG.CUGGCGA
AL939112.1/94442-94322               UGCUCAG.......CCCG..............CCUGAGCCGG.CGCCCGG
Z99124.2/158222-158117               CGGGA.........CAAG.............GUG.UCCUCGG.CUUUGCU
Z99110.2/200192-200316               CAUGGA........UUGU...............AUCCAUCGG.CUUUGUU
AF325827.1/1344-1451                 CGGAGUA.......UAAU...............UACUCUCGG.CUUUGUU
AF109909.2/85-201                    CAUGGA........GUAU................UCCAUCGG.CUUUGUU
AE017028.1/108421-108293             CGUAGAA.......CUUA..............GUUCUUCCGG.CUUUGUU
AE017002.1/74863-74734               CGUAGAA.......CUUA..............GUUCUUCCGG.CUUUGUU
AE017267.1/64114-64220               CAGGGA.........GAA................ACCCUCGG.CUUUAUU
AL591977.1/131463-131588             CAUGAUA.......GAGA...............UAUCAUCGG.UUUUAUC
AL596167.1/48063-48187               CAUGAUA.......GAGA...............UAUCAUCGG.UUUUAUC
AF270169.1/2621-2476                 CGAAGA........UAAG................UCUUCCGG.UAAAGUG
AE016746.1/110388-110533             CGAAGA........UAAG................UCUUCCGG.UAAAGUG
Y14370.1/1315-1188                   CGAAG.........AUAU.................CUUCCGG.UAAAGUG
AE015938.1/76711-76816               CGGCAA........UUAA................A.GCCCGG.AUAGUUA
AE012978.1/1-99                      CGGC..........UUUU...............U..GCCCGG.CUGAUUG
AE012997.1/6989-7110                 CGGGAA.........AUU................UUCUCCGG.CAGGUUA
AE016953.1/48442-48336               CGAAA.........GCAA.................UUUCUGG.UGUUGUC
AE017205.1/106071-105970             CGAGAU........GGAU................AUCUCUGG.ACUUAUC
AL935253.1/180146-180248             AGAA..........GCCA..................AUCCGG.UAUUGUC
AE014915.1/3159-3261                 CGAAA.........CUGU.................UUUCCGG.CAACAUA
AE010002.1/2251-2354                 CGGAAU........UUCG................GUUUCCGG.UACAAUC
AE014215.1/8470-8571                 CGAAA.........GAAA.................UUUCCGG.CGUUGUC
AE007449.1/12778-12662               CGAAUUUUAUGCU.GAAA..........AGUAUGCUUUCCGG.CCCUAUC
AE005906.1/7630-7499                 UUGAUC........UUCC...............GGAUCAUGG.CGCGGGG
AL646068.1/58739-58896               UUGACCGUCGUC..GCAA........UGGCAGACGGUUAUGG.CGUGGUC
AL646061.1/184783-184648             CGAAGC........GCAC................GCUUCCGG.UCGUGCC
BX321864.1/302773-302659             UUGACC........GGCA................GGUCAUGG.CGUAAGC
AE015551.1/8187-8055                 UUGGC.........CGCA...............U.GCCAUGG.UGUUCAC
U18997.1/19117-19256                 CGAUGUGU......GAAA............AAACACAUCCGG.UCACCGG
AE016761.1/247677-247799             UCGUU.........GCAA.................AACGUGG.CACGUAC
D90826.1/6621-6743                   UCGUU.........GCAA.................AACGUGG.CACGUAC
BX571872.1/163681-163547             CGAUGC........AACA................GCAUCCGG.UAGCCGG
AE008781.1/18002-18124               UCGUU.........GCAA.................AACGUGG.CGCGUAC
AE008848.1/13783-13922               CGAUGUGUG.....CAAA.............ACCACAUCCGG.UCACCGG
AE016837.1/226247-226125             UCGUU.........GCAA.................AACGUGG.CGCGUAC
AE013857.1/9631-9778                 UCGUUUCA......UUUA............UUUGAAACGUGG.UACGGGC
AE016776.1/272500-272339             UUGGUC........CACA................GACCAUGG.CGCGUGC
AE004877.1/3967-4112                 UUGGUC........CGCA................GACCAUGG.CGCGCGC
AE004717.1/4063-3947                 UUGGCA.........ACC................UGCCAUGG.CCAGCGC
AE016809.1/257790-257673             CCGAGC........UUAA...............UGCUUGUGG.UAUUCAC
AE004385.1/7550-7674                 CGUUGAGU......UUCA...............CUCAACCGG.CAAAUAU
AE004094.1/6414-6545                 UUGGUAC.......UCAA...............UUACCAUGG.UGUGUGA
AE012529.1/9465-9584                 UCGGCC........GUUG................CGCCGUGG.UGCGGGC
AE012090.1/10837-10947               CGAGCCC.......GCCA.........UGUGCAGCGCUCCGG.UGCAACG
AE012550.1/9704-9824                 CGAGCCCUGCCU..GUCA..............GGCGCUCCGG.UGCAACG
AE012070.1/1125-1243                 UCGGC.........CAGU..............GC.GCCGUGG.UGCAGGC
AE012558.1/14966-15083               UCGGUA........CAUA................U.CCGUGG.CGC.AGC
#=GC SS_cons                         .<<<<<............................>>>>>>>>.>>>>>>>

BX927153.1/297716-297548             ..GCCCAUUUUGUUU.....UUCA.......GAUGCAUGUUAGAUGCGUU
BX248358.1/90582-90421               G.GUUUACUUUGAUUUUAGGUUAU..........UUGCUCAAGCAGGCCG
BX842584.1/155440-155547             ..ACCGUUUG..........AUAC..........................
AL939112.1/94442-94322               A.GGCAGGCCUCGUGCG...CGAG..........................
Z99124.2/158222-158117               ..GGCAAU............CUC...........................
Z99110.2/200192-200316               ..GGCAUGCCU.........GAAU..........................
AF325827.1/1344-1451                 ..GGCAAC............GAUC..........................
AF109909.2/85-201                    ..GGCAUAA...........UGA...........................
AE017028.1/108421-108293             ..GGCAUUUUCA........UUAC..........................
AE017002.1/74863-74734               ..GGCAUUUUUUA.......UUAC..........................
AE017267.1/64114-64220               G.GCAACG............UUU...........................
AL591977.1/131463-131588             ..ACAUUUA...........ACUU..........................
AL596167.1/48063-48187               ..ACAUUUA...........ACUU..........................
AF270169.1/2621-2476                 ..GGCAAA............AAU...........................
AE016746.1/110388-110533             ..GGCAAA............AAU...........................
Y14370.1/1315-1188                   ..GGCAAU............UAA...........................
AE015938.1/76711-76816               ..CUCC..............AAAG..........................
AE012978.1/1-99                      A.GCAG..............AUA...........................
AE012997.1/6989-7110                 ..GAAACUCCG.........GACG..........................
AE016953.1/48442-48336               U...................UAAA..........................
AE017205.1/106071-105970             ....................UUAA..........................
AL935253.1/180146-180248             U...................UAAA..........................
AE014915.1/3159-3261                 U...................UAAA..........................
AE010002.1/2251-2354                 U...................UAAA..........................
AE014215.1/8470-8571                 U...................UAAA..........................
AE007449.1/12778-12662               U...................UAAA..........................
AE005906.1/7630-7499                 AAGGGAAGCGGACU......UGAA..........................
AL646068.1/58739-58896               A.GCAA..CA..........UCCU..............GGGUGCCCCGCA
AL646061.1/184783-184648             ..GGCAUCCGCAGGU.....UCCU........................GG
BX321864.1/302773-302659             ..GGUU..............CUA...........................
AE015551.1/8187-8055                 A.GCAAAUC...........AUC...........................
U18997.1/19117-19256                 ..GCAACCCG..........AAAG.........GAAUACGCAGACGUAUU
AE016761.1/247677-247799             G.GACUGAA...........CACU..........................
D90826.1/6621-6743                   G.GACUGAA...........UACU..........................
BX571872.1/163681-163547             ..GCAACCUUGAAC......UUAU.............ACCUGAUGGUACA
AE008781.1/18002-18124               G.GACCAGC...........CGCC..........................
AE008848.1/13783-13922               ..GCAGCCAU..........AAAG.........GAAUGCGUCAGCGUAUU
AE016837.1/226247-226125             G.GACCAGC...........CGCC..........................
AE013857.1/9631-9778                 ..AGCC...AG.........GUAA..........................
AE016776.1/272500-272339             ..GACCCACCA.........UGCACGCCUGCAUGGAGAGAUCCGCAUAGA
AE004877.1/3967-4112                 ..GACCCAAGCCUGCCCA..GACA..........................
AE004717.1/4063-3947                 ..AUCC..............AACC..........................
AE016809.1/257790-257673             ..GUUC..............AUCU..........................
AE004385.1/7550-7674                 U.AAGCUCUGAA........UCCA..........................
AE004094.1/6414-6545                 ..GACCUGA...........GCCU..........................
AE012529.1/9465-9584                 ..AACCA.............CUCU..........................
AE012090.1/10837-10947               ..GCAACCGG..........CCCG..........................
AE012550.1/9704-9824                 ..GCAACCGG..........CCCG..........................
AE012070.1/1125-1243                 ..AACCA.............GUUU..........................
AE012558.1/14966-15083               ..AACCA.............UCG...........................
#=GC SS_cons                         ..<<<<<<<.........................................

BX927153.1/297716-297548             GAGGGACAAGGGU.GGGGGAGACCUCCGGUUCUUAA
BX248358.1/90582-90421               GAUCAGAGUGAGC.GGGGGAGACCUCCGGUUCAUCU
BX842584.1/155440-155547             ......CAACGGU.GGGCGAGACCUUCGACCGAUGU
AL939112.1/94442-94322               ......GCGGGCC..AGCGAGACCUUCGGCAAGCAG
Z99124.2/158222-158117               .......AUUGUU..AGCGAGACCUUUGCCAAAUCU
Z99110.2/200192-200316               ......UCAUGUC.UAGCAAGACCUUUGCCUUAUGU
AF325827.1/1344-1451                 .......GUUGUU..AGCAAGACCUUUACUCGAGAU
AF109909.2/85-201                    ......UUAUGCU.UAGCAAGACCUUUGCCAUAUUU
AE017028.1/108421-108293             ......AUAUGUC.UAGCAAGACCUUUGCCUAUUAA
AE017002.1/74863-74734               ......AUAUGUC.UAGCAAGACCUUUGCCUAUUAA
AE017267.1/64114-64220               .......CGUUGU.UAGUGAGACCUUUACCAGCAAU
AL591977.1/131463-131588             ......UAAAUGU.UAGCGAGACCUUUGCCUUUACG
AL596167.1/48063-48187               ......UAAAUGU.UAGCGAGACCUUUGCCUUUAUG
AF270169.1/2621-2476                 .......AUUGCU.AAGUGAGACCUUUGCUAUUAAA
AE016746.1/110388-110533             .......AUUGCU.AAGUGAGACCUUUGCUAUUAAA
Y14370.1/1315-1188                   .......AUUGCU.UAGUGAGACCUUUGCUAUUUAU
AE015938.1/76711-76816               .........AGAGAUUGCAAGACCUUUGUUCUACAG
AE012978.1/1-99                      .........AUGC.GAGUGAGACCUUUACUUUGUGG
AE012997.1/6989-7110                 ......GAGUUUU.GAGCAAGACCUUUAUAGAGGUA
AE016953.1/48442-48336               ..............CGGUGAGACUUAUGUAUGUUCG
AE017205.1/106071-105970             .............UUAGUGAGACUUAUGACUGAUAA
AL935253.1/180146-180248             ..............UAGUGAGACUUAUGUAUGUUCA
AE014915.1/3159-3261                 ..............UAGCGAGACUUGUUUAAUUAUU
AE010002.1/2251-2354                 ..............CAGCGAGACUUGUUUAAGAAAA
AE014215.1/8470-8571                 ..............CAGCGAGACUUGUUUUCAUAAA
AE007449.1/12778-12662               ..............CAGCGAGACUUGUUAUGAUUAA
AE005906.1/7630-7499                 ......GCUUCCU.UGGCGAGACCAAUGGCGCCGAU
AL646068.1/58739-58896               CCCGGUGACGCGCCUGGCGAGACCGAUGACACGCCU
AL646061.1/184783-184648             CCUGCCGG.UGUC.GAGCAAGACCUUUGCAACCGGA
BX321864.1/302773-302659             .........AGCC.UGGCAAGACCUUUGACCACAAU
AE015551.1/8187-8055                 ......GAUUUGUCUUGCAAGACCUGAGCACAAUAA
U18997.1/19117-19256                 CCUUUUUUGUUGU.AAGUGAGACCUU.GCCGGAAGG
AE016761.1/247677-247799             ......UUCAGUC.AGGCGAGACCAUAUGCACAUCA
D90826.1/6621-6743                   ......UUCAGUC.AGGCGAGACCAUAUGCACAUCA
BX571872.1/163681-163547             UUUUCUGUGUUGU.AAGUGAGACCUU.GCCAGAAGG
AE008781.1/18002-18124               ......GCUGGUC.AGGCGAGACCAUAGGCGCAUCA
AE008848.1/13783-13922               CCUUUAUUGUUGU.AAGUGAGACCUU.GCCGAAUGG
AE016837.1/226247-226125             ......GCUGGUC.AGGCGAGACCAUAGGCGCAUCA
AE013857.1/9631-9778                 .........GGUU..GGCGAGACCAUAGACACGUAG
AE016776.1/272500-272339             CGGAUCGAGGGUU.UGACAAGACCUAUGACACGCAC
AE004877.1/3967-4112                 ..GGCCAAGGGUU.UGACAAGACCUAUGACACGCAC
AE004717.1/4063-3947                 .........GGAU.UGGUGAGACCAACGACAUUCCU
AE016809.1/257790-257673             .........GUUC.UGGCAAGACUUAAGCAAAGUUU
AE004385.1/7550-7674                 .AGUUCAACGCUU.CGACGAGACCAACGCAUUCAAU
AE004094.1/6414-6545                 ......UCAGGUU.UAGCAAGACCUUAGACAAACAA
AE012529.1/9465-9584                 ........UGGUU.UGGCGAGACCAGCGGCAUGCGU
AE012090.1/10837-10947               ....GCCGGUUGC.GAGCGAGACCUU..........
AE012550.1/9704-9824                 ....GCCGGUUGC.GAGCGAGACCUUCGCCGCGCAG
AE012070.1/1125-1243                 ........CGGUU.UGGCGAGACCAGCGGCAUGCGU
AE012558.1/14966-15083               ........UGGUU.UGGCGAGACCAACGGCUCGUGU
#=GC SS_cons                         ......>>>>>>>.>>>>....>>>>>>>>>.....
//

Department of Computer Science and Information Engineering, National Central University, Tao-yuan, Taiwan
Contact with site administrator:
Tzu-Hao Chang