RNALogo - a new approach to display structural RNA alignment
Home CreateLogo Gallery Documentation Help

► The RNALogo of RF00162 family:
 


See detail values
See the detail description of RF00162 in Rfam
 

► The SequenceLogo of RF00162 family:

► Reset display of RNALogo of RF00162 family:
 Family sequences selection : Seed ( 48 seqs.) Full ( 298 seqs.)
 Output image format :  
 Output image size :   x pixel

 


► The sequences in RF00162 family:
# STOCKHOLM 1.0

#=GF AC   RF00162
#=GF ID   SAM
#=GF DE   SAM riboswitch (S box leader)
#=GF PI   S_box;
#=GF AU   Griffiths-Jones SR
#=GF SE   Grundy F, Henkin T, PMID:10094622
#=GF SS   Published; PMID:10094622
#=GF GA   38.00
#=GF TC   41.88
#=GF NC   34.99
#=GF TP   Cis-reg; riboswitch;
#=GF BM   cmbuild CM SEED
#=GF BM   cmsearch -W 200 CM SEQDB
#=GF RN   [1]
#=GF RM   10094622
#=GF RT   The S box regulon: a new global transcription termination control
#=GF RT   system for methionine and cysteine biosynthesis genes in
#=GF RT   gram-positive bacteria.
#=GF RA   Grundy FJ, Henkin TM;
#=GF RL   Mol Microbiol 1998;30:737-749.
#=GF RN   [2]
#=GF RM   12910260
#=GF RT   An mRNA structure that controls gene expression by binding
#=GF RT   S-adenosylmethionine.
#=GF RA   Winkler WC, Nahvi A, Sudarsan N, Barrick JE, Breaker RR;
#=GF RL   Nat Struct Biol 2003;10:701-707.
#=GF RN   [3]
#=GF RM   12702767
#=GF RT   The riboswitch-mediated control of sulfur metabolism in bacteria.
#=GF RA   Epshtein V, Mironov AS, Nudler E;
#=GF RL   Proc Natl Acad Sci U S A 2003;100:5052-5056.
#=GF RN   [4]
#=GF RM   15215334
#=GF RT   Comparative genomics of the methionine metabolism in Gram-positive
#=GF RT   bacteria: a variety of regulatory systems.
#=GF RA   Rodionov DA, Vitreschak AG, Mironov AA, Gelfand MS;
#=GF RL   Nucleic Acids Res 2004;32:3340-3353.
#=GF RN   [5]
#=GF RM   16810258
#=GF RT   Structure of the S-adenosylmethionine riboswitch regulatory mRNA
#=GF RT   element.
#=GF RA   Montange RK, Batey RT;
#=GF RL   Nature. 2006;441:1172-1175.
#=GF CC   The SAM riboswitch is found upstream of a number of genes which
#=GF CC   code for proteins involved in methionine or cysteine biosynthesis
#=GF CC   in Gram-positive bacteria.  The SAM riboswitch acts at the level
#=GF CC   of transcription termination control.  The predicted structure
#=GF CC   consists of a complex stem-loop region followed by a single stem
#=GF CC   loop terminator region.  An alternative and mutually exclusive
#=GF CC   form involves bases in the 3' segment of helix 1 with those in
#=GF CC   the 5' region of helix 5 to form a structure termed the
#=GF CC   anti-terminator form [1].  This entry represents the conserved
#=GF CC   core of the complex structure involving helices 1-4.
#=GF SQ   48

AL939119.1/177986-178133             CGCUCAUCCAGAG.GGGCAGAGGGAU.ACGG.CCCGAUGAAGCCC.CGGC
Z99123.2/187154-187260               ACCUUAUCAAGAG.AGGUGGAGGGA..CUGG.CCCUAUGAUACC..CGGC
AF027868.1/5245-5154                 UUUCUAUCCAGAG.AGGUGGAGGGA..CUGG.CCCUAUGAAACCU.CGGC
U52812.1/691-829                     CUCUUAUCCCGAGCUGGCGGAGGGA..CAGG.CCCUAUGAAGCC..CAGC
Z99109.2/169069-168952               UUCUUAUCAAGAG.AAGCAGAGGGA..CUGG.CCCGACGAAGCUU.CAGC
Z99119.2/114925-114787               CUCUUAUCCCGAGCUGGCGGAGGGA..CAGG.CCCUAUGAAGCC..CAGC
Z99110.2/47875-47995                 UUCUUAUCGUGAG.AGGUGGAGGGA..CUGG.CCCUUAGAAACCU.CAGC
Z99111.2/13049-12893                 CUCUUAUCGAGAGUUGGGCGAGGGAU.UUGG.CCUUUUGACCCCAAAAGC
Z99111.2/15242-15342                 UUCUUAUCAAGAGCAGGCAGAGGGA..CGAG.CCCGAUGAAGCC..CGGC
Z99123.2/188544-188650               UCCUUAUCAAGAG.AGGUGGAGGGA..CUGG.CCCUGCGAUACC..CGGC
AJ000974.1/281-386                   AACUUAUCAAGAG.CGGCUGAGGGA..CUGG.ACCUAUGAAGCC..CGGC
AJ002571.1/38016-37861               CUCUUAUCGAGAGUUGGGCGAGGGA..UUGG.CCUUUUGACCCCAACAGC
Z99120.2/150201-150095               CUCUUAUCAAGAG.AGGUGGAGGGA..AGUG.CCCUAUGAAGCC..CGGC
AL596165.1/180914-180814             UUCUUAUCACGAA.AGGUGGAGGGA..CUGG.CCCUUUGAAGCCU.UAGC
AL591976.1/242770-242867             AACUUAUCAAGAA.AGGUGGAGGGUU.CUGG.CCCCGUGAAGCCU.UGGC
AL591980.1/89597-89491               CUCUUAUAAUGAG.UGGUAGAGGGA..CUGG.CCCGUUGAAACC..CGGC
AL596163.1/172398-172500             UUCUUAUCCAGAG.UGGUGGAGGGAA.UCGG.CCCAGUGAAACC..CGGC
AL591983.1/96176-96058               AUCUUAUCCAGAG.UGGUGGAGGGA..AAUG.CCCUAUGAAGCC..CAGC
AL596170.1/192-86                    CUCUUAUUAUGAG.UGGUAGAGGGA..CUGG.CCCGUUGAAACC..CAGC
AL591980.1/66651-66543               CUCUUAUCCAGAG.CGGUAGAGGGA..CUGA.CCCUUUGAAGCC..CAGC
AL596166.1/166748-166844             AACUUAUCAAGAA.AGGUGGAGGGUU.CUGG.CCCAGUGAAGCCU.UGGC
AL596172.1/176254-176136             AUCUUAUCCAGAG.UGGUGGAGGGA..AAUG.CCCUGUGAAACC..CAGC
AL596164.1/95936-95817               CUCUUAUCGAGAG.CGGCAGAGGGA..CUGG.CCCGAUGAAGCC..CGGC
AL591974.1/109385-109266             CUCUUAUCGAGAG.CGGCAGAGGGA..CUGG.CCCGAUGAAGCC..CGGC
AL596169.1/221462-221354             CUCUUAUCCAGAG.CGGUAGAGGGA..CUGA.CCCUUUGAAGCC..CAGC
AL591973.1/137133-137235             UUCUUAUCAAGAG.UGGUGGAGGGA.AUCGG.CCCAGUGAAACC..CAGC
U36379.1/1-106                       AUCCU.....GAG.UGGUGGAGGGAC.AUGGACCCAAUGAAACC..CAGC
AE016745.1/287368-287470             CUCUUAUCGAGAG.AGGUGGAGGGA..UGUG.CCCUAAGAAGCC..CGGC
AF270301.1/145-36                    CUCUUAUCCUGAG.UGGUGGAGGGA.CAUGGACCCAAUGAAACC..CAGC
AF269983.1/571-671                   ACCUUAUUUUGAG.AAGCUGAGGGAU.UUGG.CCCAUAGAAGCUU.CAGC
AE016744.1/15971-16071               ACCUUAUUUUGAG.AAGCAGAGGGAU.UUGG.CCCGUAGAAGCUU.CAGC
AE016750.1/132874-132778             AACUUAUCAAGAG.AAGUGGAGGGA..CUGG.CCCAAAGAAGCUU.CGGC
L42943.1/254-144                     CUCUUAUCCUGAG.UGGUGGAGGGA.CAUGGACCCAAUGAAACC..CAGC
AE007608.1/12720-12617               UCCUUAUCAAGAG.AAACGGAGGGA..CUGG.CCCAAUGAUGUUU.CAGC
AE007554.1/96-198                    UUCUUAUCAAGAG.UGACGGAGGGA..UAGG.CCCUAUGAAGUC..CGGC
AE015940.1/18048-17945               AUCUUAUCAAGAG.CGGUUGAGGGA..CUGG.CCCUAUGAAACC..CAGC
AE007573.1/4052-3947                 AUCUUAUCAAGAG.UGGUGGAGGGA..CUGG.CCCUUUGAAACC..CGGC
AE007776.1/3380-3272                 GUCUUAUCAAGAG.AGGUGGAGGGA..CUGG.CCCUAUGAAACC..CAAC
AE007614.1/6196-6300                 CACUUAUCAAGAG.AGGUGGAGGGA..CCGG.CCCUGUGAAGCC..CAGC
AE015937.1/3369-3474                 CUCUUAUCGAGAG.AGGUGGAGGGAA.AGGG.CCCUAUGAAACC..CGGC
AE015940.1/248618-248510             AGCUUAUUAAGAG.CGGUGGAGGGA..CUGG.CCCUAUGAAGCC..CGGC
AE007691.1/7901-8001                 UUCUUAUCAAGA..AGGUGGAGGGA..CUGG.CCCUAUGAAGCC..UGAC
AE007783.1/7014-6904                 CUCUUAUCAAGAG.AGGUGGAGGGAA.AGGG.CCCGUUGAAACC..CGGC
AB090330.1/380-279                   UACUUAUCAAGAG.CGGUGGAGGGA..CUGG.CCCUAUGAAGCC..CAGC
AE015944.1/267219-267117             UUCUUAUCAAGAG.AGGCGGAGGGA..CUGG.CCCUAUGAAACC..CGGC
AE013132.1/12640-12541               CUCUUAUCAAGAG.AGGUGGAGGGA..CUGG.CCCGAUGAAACC..CGGC
AE013162.1/3974-3865                 CUCUUAUCAAGAG.UGGUGGAGGGA..CUGG.CCCGAUGAAACC..CGGC
AE013020.1/702-811                   CUCUUAUCAAGAG.AGGUGGAGGGAA.AGAG.CCCGAUGAAACC..CGGC
#=GC SS_cons                         <<<<<<<<.......<<<...<<<........>>>......>>>...<<<

AL939119.1/177986-178133             AACCCUCCAGUCGGUUCUUGUCACACGGACGUGGCGAGGCUCCCGG....
Z99123.2/187154-187260               AACCGCUGUUUCA.....................................
AF027868.1/5245-5154                 AACA....UU........................................
U52812.1/691-829                     AACCGGUUUCUCUGUUAUUUAUUAUGUUCAAUUGAGUGAG..........
Z99109.2/169069-168952               AACCGGUGUAAUGGCGAUCAGCC...........................
Z99119.2/114925-114787               AACCGGUUUCUCUGUUAUUUAUUAUGUUCAACUGAGUGAG..........
Z99110.2/47875-47995                 AACCGGCUUGUUUUGCAUUUGCAA..........................
Z99111.2/13049-12893                 AACCGACCGUAAUUCCAUUGUGAAAUGGGGCGCAUUUUUUUCGCGCCGAG
Z99111.2/15242-15342                 AACCGACUUAU.......................................
Z99123.2/188544-188650               AACCGCUGUUU.......................................
AJ000974.1/281-386                   AACCUGCAUAG.......................................
AJ002571.1/38016-37861               AACCGACCGUAAUACCAUUGUGAAAUGGGGCGCACUGCUUUUCGCGCCGA
Z99120.2/150201-150095               AACCAUCAACACU.....................................
AL596165.1/180914-180814             AACCGGAAUUU.......................................
AL591976.1/242770-242867             AACCGGAUUU........................................
AL591980.1/89597-89491               AACCUUUCAAUACG....................................
AL596163.1/172398-172500             AGCGGAGCGC........................................
AL591983.1/96176-96058               AACCUAAACAAUAAUUCAUUAU............................
AL596170.1/192-86                    AACCUUUCAAUUCG....................................
AL591980.1/66651-66543               AACCUACACAUAU.....................................
AL596166.1/166748-166844             AACCGGACUU........................................
AL596172.1/176254-176136             AACCUAAACAAUAAUUCAUUAU............................
AL596164.1/95936-95817               AACCUAACUUUAUUUAAGCGU.............................
AL591974.1/109385-109266             AACCUAACUUUAUUUAAGCAU.............................
AL596169.1/221462-221354             AACCUACACAUAU.....................................
AL591973.1/137133-137235             AGCGGAGCGC........................................
U36379.1/1-106                       AACCUCUUUUUUAU....................................
AE016745.1/287368-287470             AACCGUCUAAA.......................................
AF270301.1/145-36                    AACCUCUUUAUU......................................
AF269983.1/571-671                   AACCGACUUUA.......................................
AE016744.1/15971-16071               AACCGACUUUA.......................................
AE016750.1/132874-132778             AACA...UUGU.......................................
L42943.1/254-144                     AACCUCUUUUUUAU....................................
AE007608.1/12720-12617               AACCAAGGUUUU......................................
AE007554.1/96-198                    AACAUCCAAUUAU.....................................
AE015940.1/18048-17945               AACCUAUACACAA.....................................
AE007573.1/4052-3947                 AACCAGUAUAUUUUUU..................................
AE007776.1/3380-3272                 AACCAGCAUUUUUUAAUU................................
AE007614.1/6196-6300                 AACCUGUAUAUGUUAAU.................................
AE015937.1/3369-3474                 AACCAAUAUUUUUAGA..................................
AE015940.1/248618-248510             AACCUGUAUAUGUGUUUGCAU.............................
AE007691.1/7901-8001                 AACCGGCA..........................................
AE007783.1/7014-6904                 AACCGAUGUAUUAAUUUAAG..............................
AB090330.1/380-279                   AACCUAUAUGAAAA....................................
AE015944.1/267219-267117             AACCAAAAAUAAU.....................................
AE013132.1/12640-12541               AACCAGCCUU........................................
AE013162.1/3974-3865                 AACCGGCACGUA......................................
AE013020.1/702-811                   AACCUGUCCUUUU.....................................
#=GC SS_cons                         .<<<<<<...........................................

AL939119.1/177986-178133             .............CUAGGGAA.GGUGCCAAAUC..CGUCUCACGGCG.AG
Z99123.2/187154-187260               .............AACAGAAU.GGUGCUAAAUC..CUUAAGAACA...UU
AF027868.1/5245-5154                 ..............AU......UGUGCCAAUUC..CAGCAAGC.....GC
U52812.1/691-829                     .............ACAACCAA.GGUGCUAACCUG.UUGCAAGGUU...GU
Z99109.2/169069-168952               .............AUGACCAA.GGUGCUAAAUC..CAGCAAGCUC...GA
Z99119.2/114925-114787               .............ACAACCAA.GGUGCUAACCUG.UUGCAAGGUU...GU
Z99110.2/47875-47995                 .............AGCGCCAA.GGUGCUAAAUC..CAGCAAGCGU...UU
Z99111.2/13049-12893                 ACGCUGGUCUCU.UAAGGCAC.GGUGCUAAUUCC.AUUCAGAU.....CU
Z99111.2/15242-15342                 .............AAAG.CAC.GGUGCUAAUUC..UUGCAGCU......A
Z99123.2/188544-188650               .............AACAGAAU.GGUGCUAAAUC..CUUUAGAGCAA..UG
AJ000974.1/281-386                   .............UUUGUAA..GGUGCUACUUC..CAGCAAAAUG...AA
AJ002571.1/38016-37861               GACUGAUGUCUCAUAAGGCAC.GGUGCUAAUUC..CAUCAGAU......U
Z99120.2/150201-150095               .............GUUGAAAU.GGUGCCAAUUC..ACACGAAGC....GU
AL596165.1/180914-180814             .............AUUUUCAC.GGUGCUAAUUC..CAGCAGUA......U
AL591976.1/242770-242867             ................UUCAC.GGUGCCAAAUC..CAGCAGG......UA
AL591980.1/89597-89491               .............UUGAAAA..GGUGCUAAAUC..CUGCGAAGUG...UG
AL596163.1/172398-172500             .............AAGUUC...UAUGCUAAUUCC.GAUCAGAAG....UA
AL591983.1/96176-96058               .............GUGUUUAA.GGUGCUAAGUC..AUGCAGAACAAC.UA
AL596170.1/192-86                    .............UUGAAAA..GGUGCUAAAUC..CUGCGAAGUG...UG
AL591980.1/66651-66543               .............AAGUGAAA.GGUGCUAAUCUG.UUGCAGGAGUA..UU
AL596166.1/166748-166844             ................UUCAC.GGUGCCAAAUC..CAGCAGU.......A
AL596172.1/176254-176136             .............GUGUUUAA.GGUGCUAAGUC..AUGCAGAACAAC.GA
AL596164.1/95936-95817               .............AAAGUGAA.GGUGCUAAUUC..CAGCAAAAUGGU.GU
AL591974.1/109385-109266             .............AAAGUGAA.GGUGCUAAUUC..CAGCAAAAUGGU.GU
AL596169.1/221462-221354             .............AAGUGAAA.GGUGCUAAUCUG.UUGCAGGAGUA..AU
AL591973.1/137133-137235             .............AAGUUC...UAUGCUAAUUCC.GAUCAGAAG....UA
U36379.1/1-106                       .............AAAAGAAA.GGUGCCAAACCGUUUGCAGACA....AA
AE016745.1/287368-287470             .............AUAGAAAU.GGUGCCAAUUC..ACAUAAAGU.....A
AF270301.1/145-36                    .............UAAAGAAA.GGUGCCAAACCGUUUGCAGACAA...AU
AF269983.1/571-671                   .............AAUAGCAC.GGUGCUAAUAC..CAACGAG......CA
AE016744.1/15971-16071               .............AAUAGCAC.GGUGCUAAUAC..CAACGAG......CA
AE016750.1/132874-132778             .............AUC...A..UGUGCCAAUUC..CAGUAACCG.....A
L42943.1/254-144                     .............AAAAGAAA.GGUGCCAAACCGUUUGCAGACA....AA
AE007608.1/12720-12617               .............AUACUUAU.GGUGCUAAUUC..CAGCAGGA.....UA
AE007554.1/96-198                    .............UUUGGAGA.UGUGCUAAUUC..CUACAGGU.....UU
AE015940.1/18048-17945               .............AGUAUAAA.GGUGCUAACUC..CAGCAGGA.....AA
AE007573.1/4052-3947                 .............AAUAUAUGUGGUGCUAAAUC..CUGCAGCA......A
AE007776.1/3380-3272                 .............AGAUGUAU.GGUGUUAAUUC..CUGCAAAG.....UU
AE007614.1/6196-6300                 .............UAUACAA..GGUGCUAAUUC..CUGCAGC......GC
AE015937.1/3369-3474                 .............AGUAUUAA.GGUGCCAAUUC..CUGCAGAA......A
AE015940.1/248618-248510             .............AUUAUAA..GGUGCUAAAUC..CUGCGGU......GU
AE007691.1/7901-8001                 .............AAUGUAC..GGUGUUAAUUC..CUGCAAAACU...UA
AE007783.1/7014-6904                 .............UACAUAAU.GGUGCCAAUUC..CUGCAGAA.....UU
AB090330.1/380-279                   .............UAUAUAA..GGUGCUAAAUC..CUGCAGCA......U
AE015944.1/267219-267117             .............AAUUUUAA.GGUGCCAAUUC..CAGCAGGU......G
AE013132.1/12640-12541               .............AGGGCAU..GGUGCCAAUUC..CUGCAGCG.....GU
AE013162.1/3974-3865                 .............AGUGCUU..GGUGCCAAUUC..CUGCAGGUUGGGGUU
AE013020.1/702-811                   .............AAGGAUAA.GGUGCCAAUUC..UCUCAGAAGA...UU
#=GC SS_cons                         ................>>>...>>>>>>..........<<<<........

AL939119.1/177986-178133             AUGCGUCGUGAGGAAGAUGAGGA
Z99123.2/187154-187260               GC....GUUCUUGCAGAUGAGGC
AF027868.1/5245-5154                 UA.....GCUUGAAAGAUAGGAA
U52812.1/691-829                     AU.GAUUCCUUGAGCGAUAAGAG
Z99109.2/169069-168952               AC....AGCUUGGAAGAUAAGAA
Z99119.2/114925-114787               AU.GAUUCCUUGAGCGAUAAGAG
Z99110.2/47875-47995                 UU..UAUGCUUGGAAGAUAAGAA
Z99111.2/13049-12893                 G......AUCUGAGAGAUAAGAG
Z99111.2/15242-15342                 GC.....GGCUGAGAGAUAAGAU
Z99123.2/188544-188650               AU...UGCUCUUGAAGAUAAGGU
AJ000974.1/281-386                   UU..CCAUUUUGAAAGAUAAGGG
AJ002571.1/38016-37861               GU.....GUCUGAGAGAUGAGAG
Z99120.2/150201-150095               UC...AGCUUUGAAAGAUGAGAG
AL596165.1/180914-180814             A......UUCUGAAAGAUAAGUC
AL591976.1/242770-242867             AC......ACUGACAGAUAAGGC
AL591980.1/89597-89491               AU....GCUUCGAGAGAUAAGAG
AL596163.1/172398-172500             AU....AUUCUGGCAGAUAAGUA
AL591983.1/96176-96058               AU...UGUUCUGAAAGAUGAGAA
AL596170.1/192-86                    AU....GCUUCGAGAGAUAAGAG
AL591980.1/66651-66543               AU....CUUCUGAACGAUGAGAG
AL596166.1/166748-166844             UC......ACUGACAGAUAAGGC
AL596172.1/176254-176136             UU...UGUUCUGAAAGAUGAGAA
AL596164.1/95936-95817               AU.UCCGUUUUGGUAGAUAAGAG
AL591974.1/109385-109266             AU.UCCGUUUUGGUAGAUAAGAG
AL596169.1/221462-221354             AU....CUCCUGAACGAUGAGAG
AL591973.1/137133-137235             AU....AUUCUGGCAGAUAAGUA
U36379.1/1-106                       UA....GGUCUGAACGAUAAGAG
AE016745.1/287368-287470             UA....ACUUUAGAAGAUGAGAG
AF270301.1/145-36                    AU....GGUCUGAACGAUAAGAG
AF269983.1/571-671                   A.......CUCGAAUGAUAAGUA
AE016744.1/15971-16071               A.......CUCGAAUGAUAAGUA
AE016750.1/132874-132778             GA....AGGUUAGAAGAUAAGGU
L42943.1/254-144                     UA....GGUCUGAACGAUAAGAG
AE007608.1/12720-12617               UU.....UUCUGAAAGAUGAGGA
AE007554.1/96-198                    A......UCCUGAGAGAUGAGAA
AE015940.1/18048-17945               UU.....UCCUGAAAGAUAAGAA
AE007573.1/4052-3947                 A......CGCUGAUAGAUGAGAA
AE007776.1/3380-3272                 AA.....UUUUGAGAGAUAAGAG
AE007614.1/6196-6300                 UA......GCUGAGAGAUGAGAA
AE015937.1/3369-3474                 G......UUCUGCAAGAUAAGAG
AE015940.1/248618-248510             AA......ACCGAGAGAUGAGGA
AE007691.1/7901-8001                 UU...UGUUUUGAAAGAUAAGAA
AE007783.1/7014-6904                 A......UUCUGCAAGAUAAGAG
AB090330.1/380-279                   A......AGCUGAGAGAUGAGGA
AE015944.1/267219-267117             AA.....ACCUGACAGAUAAGAC
AE013132.1/12640-12541               UU.....CGCUGAAAGAUGAGAG
AE013162.1/3974-3865                 AC..CCAGCCUGAGAGAUGAGAG
AE013020.1/702-811                   UU..UUCUUCUGAAAGAUGAGGG
#=GC SS_cons                         ........>>>>...>>>>>>>>
//

Department of Computer Science and Information Engineering, National Central University, Tao-yuan, Taiwan
Contact with site administrator:
Tzu-Hao Chang