RNALogo - a new approach to display structural RNA alignment
Home CreateLogo Gallery Documentation Help

► The RNALogo of RF00167 family:
 

Note : You need the Adobe SVG plugin or an SVG enabled browser to view the graphics (Download)
           (For obtaining the complete functions and best resolution of SVG, we strongly recommand using the Internet Explore for browsing.)
See detail values
See the detail description of RF00167 in Rfam
 

► The SequenceLogo of RF00167 family:

► Reset display of RNALogo of RF00167 family:
 Family sequences selection : Seed ( 22 seqs.) Full ( 122 seqs.)
 Output image format :  
 Output image size :   x pixel

 


► The sequences in RF00167 family:
# STOCKHOLM 1.0

#=GF AC   RF00167
#=GF ID   Purine
#=GF DE   Purine riboswitch
#=GF AU   Boese B, Barrick JE, Breaker RR
#=GF SE   Boese B, Barrick JE
#=GF SS   Published; PMID:12787499
#=GF GA   45.00
#=GF TC   50.93
#=GF NC   37.16
#=GF TP   Cis-reg; riboswitch;
#=GF BM   cmbuild CM SEED
#=GF BM   cmsearch -W 150 CM SEQDB
#=GF RN   [1]
#=GF RM   12787499
#=GF RT   Riboswitches Control Fundamental Biochemical Pathways in Bacillus
#=GF RT   subtilis and Other Bacteria.
#=GF RA   Mandal M, Boese B, Barrick JE, Winkler WC, Breaker RR;
#=GF RL   Cell 2003;113:577-586.
#=GF RN   [2]
#=GF RM   14718920
#=GF RT   Adenine riboswitches and gene activation by disruption of a
#=GF RT   transcription terminator.
#=GF RA   Mandal M, Breaker RR;
#=GF RL   Nat Struct Mol Biol 2004;11:29-35.
#=GF RN   [3]
#=GF RM   15549109
#=GF RT   Structure of a natural guanine-responsive riboswitch complexed with
#=GF RT   the metabolite hypoxanthine.
#=GF RA   Batey RT, Gilbert SD, Montange RK;
#=GF RL   Nature. 2004;432:411-415.
#=GF CC   Riboswitches are metabolite binding domains within certain messenger
#=GF CC   RNAs that serve as precision sensors for their corresponding targets.
#=GF CC   Allosteric rearrangement of mRNA structure is mediated by ligand
#=GF CC   binding, and this results in modulation of gene expression. A class
#=GF CC   of riboswitches that selectively recognises guanine and becomes
#=GF CC   saturated at concentrations as low as 5 nM. In Bacillus subtilis,
#=GF CC   this mRNA motif is located on at least five separate transcriptional
#=GF CC   units that together encode 17 genes that are mostly involved in
#=GF CC   purine transport and purine nucleotide biosynthesis. It has also been
#=GF CC   shown that some members of this family are specific for adenine
#=GF CC   instead.  Hence this family are termed purine riboswitches.
#=GF SQ   22

Z99123.2/194904-195003               ...CUUAGAAAAAGACAUUCUUGUAUAUGAUCAGUAAUAUGG.UCUGAUU
X83878.1/168-267                     UUACAAUAUAAUAGGAACACUCAUAUAAUCGCGUGGAUAUGG.CACGCAA
U51115.1/15592-15691                 ...GAAAUCAAAACACGACCUCAUAUAAUCUUGGGAAUAUGG.CCCAUAA
Z99107.2/86084-86183                 ...GAAAUCAAAACACGACCUCAUAUAAUCUUGGGAAUAUGG.CCCAUAA
Z99107.2/82145-82244                 AGAAAUCAAAUAAGAUGAAUUCGUAUAAUCGCGGGAAUAUGG.CUCGCAA
Z99107.2/14363-14264                 AAUUAAAUAGCUAUUAUCACUUGUAUAACCUCAAUAAUAUGG.UUUGAGG
AB008757.1/115-16                    AAUGAAUCACGCUGACUCACUCAUAUAAUCGCAAGAAUACGG.CUUGCGA
AL596170.1/223345-223246             AUAACUUAAAACCGAAAUACUUAUAUAAUAGUUGCGAU.UGG.GCGACGA
AL596165.1/154156-154057             AAUCGUCUACAAUAAUAAAGUCGUAUAAGUUCGGUAAUAUGG.ACCGUUC
AL591981.1/205922-205823             AUAACUUAAAACCGAAAUACUUGUAUAAUAGUUGCGAU.UGG.GCGACGA
AL591975.1/251119-251020             AAUCCGCUACAAUAAUAUAGUCGUAUAAGUUCGGUAAUAUGG.ACCGUUC
AF270087.1/2580-2679                 ...AAAAUAAUUUAUAUGACUCAUAUAAUCUAGAGAAUAUGGCUUUAGAA
AE007602.1/8615-8714                 UAUAUAAAAAACUAAAUUUCUCGUAUA.CACCGGUAAUAUGG.UCCGGAA
AE007768.1/1788-1690                 AAUCGUUAAUAUAGUUUAACUCAUAUAU.UUCCUGAAUAUGG..CAGGAU
AE007775.1/3558-3459                 GAAAAGUAAUAACAUAUUACCCGUAUAUGCUUAGAAAUAUGG.UCUAAGC
AE015944.1/141656-141558             CUCUAUAAUAAAUUAUUGACUCAUAUAUCCCCU.UAAUAAGG.U.AGGGA
AE013027.1/8237-8336                 AAAAAUUUAAUAAGAAGCACUCAUAUAAUCCCGAGAAUAUGG.CUCGGGA
AE006347.1/1212-1310                 UAGUCUAUAAUAGAACAAUCUUAUUUAU.ACCUAGGAUAUGG..CUGGGC
AE014152.1/30424-30520               UGAAUUCAAUAAUGACAUACUUAUUUAU.GCUGUGAAU.UGG..CGCAGC
AE014241.1/16113-16017               CAAUUAAAUAUAUGAUUUACUUAUUUAU.GCUGAGGAU.UGG.CUUAG.C
AE007476.1/6452-6548                 AAAAUUGAAUAUCGUUUUACUUGUUUAU.GUCGUGAAU.UGG.CACGA.C
AE016809.1/202496-202595             .ACUUUCGGCGAUCAACGCUUCAUAUAAUCCUAAUGAUAUGG.UUUGGGA
#=GC SS_cons                         .................<<<<<<<<...<<<<<<<........>>>>>>>

Z99123.2/194904-195003               GUUUCUACCUAGUAACCGUAAAAAACUAGACUACAAGAAAGUUUGAAUAA
X83878.1/168-267                     GUUUCUACCGGGCA.CCGUAAA.UGUCCGACUAUGGGUGAGCAAUGGAAC
U51115.1/15592-15691                 GUUUCUACCCGGCAACCGUAAAUUGCCGGACUAUGCAGGGAAGUGAUCGA
Z99107.2/86084-86183                 GUUUCUACCCGGCAACCGUAAAUUGCCGGACUAUGCAGGAAAGUGAUCGA
Z99107.2/82145-82244                 GUCUCUACCAAGCUACCGUAAAUGGCUUGACUACGUAAACAUUUCUUUCG
Z99107.2/14363-14264                 GUGUCUACCAGGAA.CCGUAAA.AUCCUGAUUACAAAAUUUGUUUAUGAC
AB008757.1/115-16                    GUCUCUACCAGCCGACCGUAAAUCGGCUGACUAUGAGUGGCAAUGUCAGG
AL596170.1/223345-223246             GUUUCUACCUGGUUACCGUAAAUAACCGGACUAUGAGUAGUUUGUAUAAA
AL596165.1/154156-154057             GUUUCUACCAGGCAACCGUAAAAUGCCAGGCUACGAGCUAUUGUAAAAUU
AL591981.1/205922-205823             GUUUCUACCUGGUUACCGUAAAUAACCGGACUAUGAGUAGUUUGUAUAAA
AL591975.1/251119-251020             GUUUCUACCAGGCAACCGUAAAAUGCCAGGCUACGAGCUAUUGUAAAAUU
AF270087.1/2580-2679                 GUUUCUACCGUGUCGCCAUAAACGACACGACUAUGAGUAACAAUCCAAUA
AE007602.1/8615-8714                 GUUUCUACCUGCUG.CCAUAAA.UAGCAGACUACGGGGUGUUAUUGAUAA
AE007768.1/1788-1690                 GUUUCUACAAGGAA.CCUUAAA.UUUCUUACUAUGAGUGAUUUGUUUGUA
AE007775.1/3558-3459                 GUCUCUACCGGACUGCCGUAAAUUGUCUGACUAUGGGUGUUUAUAAGUAU
AE015944.1/141656-141558             GUAUCUACCAGAAG.CCUUAAA.CUUCUGACUAUGAGUGAAUAAAGCAUU
AE013027.1/8237-8336                 GUCUCUACCGAACAACCGUAAAUUGUUCGACUAUGAGUGAAAGUGUACCU
AE006347.1/1212-1310                 GUUUCUACCUCGUA.CCGUAAA.UGCGAGACAAUAAGGAAAUUCGAUUUU
AE014152.1/30424-30520               GUCUCUACAAGACA.CCUU.AA.UGUCUAACAAUAAGUAAGCUUUUAGGC
AE014241.1/16113-16017               GUCUCUACAAGACA.CCGU.AA.UGUCUAACAAUAAGUAAGCUAAUAAAU
AE007476.1/6452-6548                 GUUUCUACAAGGUG.CCGG.AA.CACCUAACAAUAAGUAAGUCAGCAGUG
AE016809.1/202496-202595             GUUUCUACCAAGAG.CCUUAAA.CUCUUGAUUAUGAAGUCUGUCGCUUUA
#=GC SS_cons                         ........<<<<<<<.......>>>>>>>..>>>>>>>>...........

Z99123.2/194904-195003               AUUU
X83878.1/168-267                     CGC.
U51115.1/15592-15691                 UAAA
Z99107.2/86084-86183                 UAAA
Z99107.2/82145-82244                 U...
Z99107.2/14363-14264                 AUU.
AB008757.1/115-16                    A...
AL596170.1/223345-223246             GA..
AL596165.1/154156-154057             U...
AL591981.1/205922-205823             GA..
AL591975.1/251119-251020             U...
AF270087.1/2580-2679                 CAU.
AE007602.1/8615-8714                 UAUA
AE007768.1/1788-1690                 UGCA
AE007775.1/3558-3459                 U...
AE015944.1/141656-141558             GUCA
AE013027.1/8237-8336                 A...
AE006347.1/1212-1310                 UUAG
AE014152.1/30424-30520               UUGC
AE014241.1/16113-16017               AGCU
AE007476.1/6452-6548                 AGAU
AE016809.1/202496-202595             UCCG
#=GC SS_cons                         ....
//

Department of Computer Science and Information Engineering, National Central University, Tao-yuan, Taiwan
Contact with site administrator:
Tzu-Hao Chang