RNALogo - a new approach to display structural RNA alignment
Home CreateLogo Gallery Documentation Help

► The RNALogo of RF00167 family:
 


See detail values
See the detail description of RF00167 in Rfam
 

► The SequenceLogo of RF00167 family:

► Reset display of RNALogo of RF00167 family:
 Family sequences selection : Seed ( 22 seqs.) Full ( 122 seqs.)
 Output image format :  
 Output image size :   x pixel

 


► The sequences in RF00167 family:
# STOCKHOLM 1.0

#=GF AC   RF00167
#=GF ID   Purine
#=GF DE   Purine riboswitch
#=GF AU   Boese B, Barrick JE, Breaker RR
#=GF SE   Boese B, Barrick JE
#=GF SS   Published; PMID:12787499
#=GF GA   45.00
#=GF TC   50.93
#=GF NC   37.16
#=GF TP   Cis-reg; riboswitch;
#=GF BM   cmbuild CM SEED
#=GF BM   cmsearch -W 150 CM SEQDB
#=GF RN   [1]
#=GF RM   12787499
#=GF RT   Riboswitches Control Fundamental Biochemical Pathways in Bacillus
#=GF RT   subtilis and Other Bacteria.
#=GF RA   Mandal M, Boese B, Barrick JE, Winkler WC, Breaker RR;
#=GF RL   Cell 2003;113:577-586.
#=GF RN   [2]
#=GF RM   14718920
#=GF RT   Adenine riboswitches and gene activation by disruption of a
#=GF RT   transcription terminator.
#=GF RA   Mandal M, Breaker RR;
#=GF RL   Nat Struct Mol Biol 2004;11:29-35.
#=GF RN   [3]
#=GF RM   15549109
#=GF RT   Structure of a natural guanine-responsive riboswitch complexed with
#=GF RT   the metabolite hypoxanthine.
#=GF RA   Batey RT, Gilbert SD, Montange RK;
#=GF RL   Nature. 2004;432:411-415.
#=GF CC   Riboswitches are metabolite binding domains within certain messenger
#=GF CC   RNAs that serve as precision sensors for their corresponding targets.
#=GF CC   Allosteric rearrangement of mRNA structure is mediated by ligand
#=GF CC   binding, and this results in modulation of gene expression. A class
#=GF CC   of riboswitches that selectively recognises guanine and becomes
#=GF CC   saturated at concentrations as low as 5 nM. In Bacillus subtilis,
#=GF CC   this mRNA motif is located on at least five separate transcriptional
#=GF CC   units that together encode 17 genes that are mostly involved in
#=GF CC   purine transport and purine nucleotide biosynthesis. It has also been
#=GF CC   shown that some members of this family are specific for adenine
#=GF CC   instead.  Hence this family are termed purine riboswitches.
#=GF SQ   22

Z99123.2/194904-195003               ...CUUAGAAAAAGACAUUCUUGUAUAUGAUCAGUAAUAUGG.UCUGAUU
X83878.1/168-267                     UUACAAUAUAAUAGGAACACUCAUAUAAUCGCGUGGAUAUGG.CACGCAA
U51115.1/15592-15691                 ...GAAAUCAAAACACGACCUCAUAUAAUCUUGGGAAUAUGG.CCCAUAA
Z99107.2/86084-86183                 ...GAAAUCAAAACACGACCUCAUAUAAUCUUGGGAAUAUGG.CCCAUAA
Z99107.2/82145-82244                 AGAAAUCAAAUAAGAUGAAUUCGUAUAAUCGCGGGAAUAUGG.CUCGCAA
Z99107.2/14363-14264                 AAUUAAAUAGCUAUUAUCACUUGUAUAACCUCAAUAAUAUGG.UUUGAGG
AB008757.1/115-16                    AAUGAAUCACGCUGACUCACUCAUAUAAUCGCAAGAAUACGG.CUUGCGA
AL596170.1/223345-223246             AUAACUUAAAACCGAAAUACUUAUAUAAUAGUUGCGAU.UGG.GCGACGA
AL596165.1/154156-154057             AAUCGUCUACAAUAAUAAAGUCGUAUAAGUUCGGUAAUAUGG.ACCGUUC
AL591981.1/205922-205823             AUAACUUAAAACCGAAAUACUUGUAUAAUAGUUGCGAU.UGG.GCGACGA
AL591975.1/251119-251020             AAUCCGCUACAAUAAUAUAGUCGUAUAAGUUCGGUAAUAUGG.ACCGUUC
AF270087.1/2580-2679                 ...AAAAUAAUUUAUAUGACUCAUAUAAUCUAGAGAAUAUGGCUUUAGAA
AE007602.1/8615-8714                 UAUAUAAAAAACUAAAUUUCUCGUAUA.CACCGGUAAUAUGG.UCCGGAA
AE007768.1/1788-1690                 AAUCGUUAAUAUAGUUUAACUCAUAUAU.UUCCUGAAUAUGG..CAGGAU
AE007775.1/3558-3459                 GAAAAGUAAUAACAUAUUACCCGUAUAUGCUUAGAAAUAUGG.UCUAAGC
AE015944.1/141656-141558             CUCUAUAAUAAAUUAUUGACUCAUAUAUCCCCU.UAAUAAGG.U.AGGGA
AE013027.1/8237-8336                 AAAAAUUUAAUAAGAAGCACUCAUAUAAUCCCGAGAAUAUGG.CUCGGGA
AE006347.1/1212-1310                 UAGUCUAUAAUAGAACAAUCUUAUUUAU.ACCUAGGAUAUGG..CUGGGC
AE014152.1/30424-30520               UGAAUUCAAUAAUGACAUACUUAUUUAU.GCUGUGAAU.UGG..CGCAGC
AE014241.1/16113-16017               CAAUUAAAUAUAUGAUUUACUUAUUUAU.GCUGAGGAU.UGG.CUUAG.C
AE007476.1/6452-6548                 AAAAUUGAAUAUCGUUUUACUUGUUUAU.GUCGUGAAU.UGG.CACGA.C
AE016809.1/202496-202595             .ACUUUCGGCGAUCAACGCUUCAUAUAAUCCUAAUGAUAUGG.UUUGGGA
#=GC SS_cons                         .................<<<<<<<<...<<<<<<<........>>>>>>>

Z99123.2/194904-195003               GUUUCUACCUAGUAACCGUAAAAAACUAGACUACAAGAAAGUUUGAAUAA
X83878.1/168-267                     GUUUCUACCGGGCA.CCGUAAA.UGUCCGACUAUGGGUGAGCAAUGGAAC
U51115.1/15592-15691                 GUUUCUACCCGGCAACCGUAAAUUGCCGGACUAUGCAGGGAAGUGAUCGA
Z99107.2/86084-86183                 GUUUCUACCCGGCAACCGUAAAUUGCCGGACUAUGCAGGAAAGUGAUCGA
Z99107.2/82145-82244                 GUCUCUACCAAGCUACCGUAAAUGGCUUGACUACGUAAACAUUUCUUUCG
Z99107.2/14363-14264                 GUGUCUACCAGGAA.CCGUAAA.AUCCUGAUUACAAAAUUUGUUUAUGAC
AB008757.1/115-16                    GUCUCUACCAGCCGACCGUAAAUCGGCUGACUAUGAGUGGCAAUGUCAGG
AL596170.1/223345-223246             GUUUCUACCUGGUUACCGUAAAUAACCGGACUAUGAGUAGUUUGUAUAAA
AL596165.1/154156-154057             GUUUCUACCAGGCAACCGUAAAAUGCCAGGCUACGAGCUAUUGUAAAAUU
AL591981.1/205922-205823             GUUUCUACCUGGUUACCGUAAAUAACCGGACUAUGAGUAGUUUGUAUAAA
AL591975.1/251119-251020             GUUUCUACCAGGCAACCGUAAAAUGCCAGGCUACGAGCUAUUGUAAAAUU
AF270087.1/2580-2679                 GUUUCUACCGUGUCGCCAUAAACGACACGACUAUGAGUAACAAUCCAAUA
AE007602.1/8615-8714                 GUUUCUACCUGCUG.CCAUAAA.UAGCAGACUACGGGGUGUUAUUGAUAA
AE007768.1/1788-1690                 GUUUCUACAAGGAA.CCUUAAA.UUUCUUACUAUGAGUGAUUUGUUUGUA
AE007775.1/3558-3459                 GUCUCUACCGGACUGCCGUAAAUUGUCUGACUAUGGGUGUUUAUAAGUAU
AE015944.1/141656-141558             GUAUCUACCAGAAG.CCUUAAA.CUUCUGACUAUGAGUGAAUAAAGCAUU
AE013027.1/8237-8336                 GUCUCUACCGAACAACCGUAAAUUGUUCGACUAUGAGUGAAAGUGUACCU
AE006347.1/1212-1310                 GUUUCUACCUCGUA.CCGUAAA.UGCGAGACAAUAAGGAAAUUCGAUUUU
AE014152.1/30424-30520               GUCUCUACAAGACA.CCUU.AA.UGUCUAACAAUAAGUAAGCUUUUAGGC
AE014241.1/16113-16017               GUCUCUACAAGACA.CCGU.AA.UGUCUAACAAUAAGUAAGCUAAUAAAU
AE007476.1/6452-6548                 GUUUCUACAAGGUG.CCGG.AA.CACCUAACAAUAAGUAAGUCAGCAGUG
AE016809.1/202496-202595             GUUUCUACCAAGAG.CCUUAAA.CUCUUGAUUAUGAAGUCUGUCGCUUUA
#=GC SS_cons                         ........<<<<<<<.......>>>>>>>..>>>>>>>>...........

Z99123.2/194904-195003               AUUU
X83878.1/168-267                     CGC.
U51115.1/15592-15691                 UAAA
Z99107.2/86084-86183                 UAAA
Z99107.2/82145-82244                 U...
Z99107.2/14363-14264                 AUU.
AB008757.1/115-16                    A...
AL596170.1/223345-223246             GA..
AL596165.1/154156-154057             U...
AL591981.1/205922-205823             GA..
AL591975.1/251119-251020             U...
AF270087.1/2580-2679                 CAU.
AE007602.1/8615-8714                 UAUA
AE007768.1/1788-1690                 UGCA
AE007775.1/3558-3459                 U...
AE015944.1/141656-141558             GUCA
AE013027.1/8237-8336                 A...
AE006347.1/1212-1310                 UUAG
AE014152.1/30424-30520               UUGC
AE014241.1/16113-16017               AGCU
AE007476.1/6452-6548                 AGAU
AE016809.1/202496-202595             UCCG
#=GC SS_cons                         ....
//

Department of Computer Science and Information Engineering, National Central University, Tao-yuan, Taiwan
Contact with site administrator:
Tzu-Hao Chang