RNALogo - a new approach to display structural RNA alignment
Home CreateLogo Gallery Documentation Help

► The RNALogo of RF00174 family:
 


See detail values
See the detail description of RF00174 in Rfam
 

► The SequenceLogo of RF00174 family:

► Reset display of RNALogo of RF00174 family:
 Family sequences selection : Seed ( 128 seqs.) Full ( 306 seqs.)
 Output image format :  
 Output image size :   x pixel

 


► The sequences in RF00174 family:
# STOCKHOLM 1.0

#=GF AC   RF00174
#=GF ID   Cobalamin
#=GF DE   Cobalamin riboswitch
#=GF AU   Barrick JE, Breaker RR, Moxon SJ
#=GF SE   Barrick JE, Breaker RR
#=GF SS   Predicted; PFOLD
#=GF GA   32.50
#=GF TC   32.50
#=GF NC   32.40
#=GF TP   Cis-reg; riboswitch;
#=GF BM   cmbuild CM SEED
#=GF BM   cmsearch -W 500 CM SEQDB
#=GF RN   [1]
#=GF RM   12787499
#=GF RT   Riboswitches control fundamental biochemical pathways in Bacillus
#=GF RT   subtilis and other bacteria.
#=GF RA   Mandal M, Boese B, Barrick JE, Winkler WC, Breaker RR;
#=GF RL   Cell 2003;113:577-586.
#=GF RN   [2]
#=GF RM   12923257
#=GF RT   Regulation of the vitamin B12 metabolism and transport in bacteria by
#=GF RT   a conserved RNA structural element.
#=GF RA   Vitreschak AG, Rodionov DA, Mironov AA, Gelfand MS;
#=GF RL   RNA 2003;9:1084-1097.
#=GF RN   [3]
#=GF RM   14704351
#=GF RT   Coenzyme B12 riboswitches are widespread genetic control elements in
#=GF RT   prokaryotes.
#=GF RA   Nahvi A, Barrick JE, Breaker RR;
#=GF RL   Nucleic Acids Res 2004;32:143-150.
#=GF CC   Riboswitches are metabolite binding domains within certain messenger RNAs
#=GF CC   that serve as precision sensors for their corresponding targets. Allosteric
#=GF CC   rearrangement of mRNA structure is mediated by ligand binding, and this
#=GF CC   results in modulation of gene expression [1]. This family represents a
#=GF CC   cobalamin riboswitch (B12-element) which is widely distributed in 5' UTRs
#=GF CC   of vitamin B(12)-related genes in bacteria.  Cobalamin in the form of
#=GF CC   adenosylcobalamin (Ado-CBL) is known to repress expression of genes for
#=GF CC   vitamin B(12) biosynthesis and be transported by a post-transcriptional
#=GF CC   regulatory mechanism, which involves direct binding of Ado-CBL to
#=GF CC   5' UTRs [2].
#=GF SQ   128

BX248357.1/28572-28772               UGUGUUACACAUUGAUUAGGUG..CAG..................CAUA.
BX248356.1/172244-172444             CUGUACAAAUCGCACCAAGGUG..UUAGUGUU.............GGGUG
Z94723.1/23034-23246                 CACACGGCGCCAGUAUCGAGU...GAUGCUAG.............CUCA.
AL583923.1/215513-215333             GUACUAUAUGCGACACUGUGUA..UCU..................GUAAA
AE017236.1/265189-265430             AUCGAGCGAAGCAACGUUAGUA..ACGCUU....................
AE017236.1/188845-189025             CCGGGGCGGAUGCAAGAA..UG..UCACCC...............GUAAG
BX842572.1/309867-309685             CCACGCUCUGCAUGCCAAUAU...UCUUCCC..............GUCAG
BX248337.1/276050-275850             GGCAUCGAGCGGGGCAACGAUG..CUUCGC....................
BX248334.1/308192-308010             CCACGCUCUGCAUGCCAAUAU...UCUUCCC..............GUCAG
AY033236.1/563-353                   GUGUAGGCUAGUAGUGCUGGU...UCGGCUGCCC...........CACGG
AY033235.1/252-496                   GUGUACUAGGGUCAAUGUGCU...GGCCUCGG.............CCAGC
AL939130.1/261334-261631             CGGUUCCUGCCCGCAGGAGGU...GACGAGGUAC...........GCUGC
AL939107.1/140625-140436             GGACGCUGAUGGGAUGAUGGCC..GGCGACAGG............GCGAC
AL939107.1/133849-134073             AGGCUGGCCCGUGCAGCUGGUU..CGCCCCGUCC...........GCCAG
AL939110.1/156680-156867             GGGCCGUGGUGGACUUCCGG.G..GCC..................AUCUA
AL939107.1/141879-142126             ACGCUGAUGCCCGCAGUUGGU...UCGCGCCUCCUGUCCGAUCAGGUCUC
AF263012.1/9229-9015                 AGGCUGACCGGUGCAGCUGGUU..CGCCCUGUCC...........GCCAG
AL939125.1/243385-243171             CCUGCUUGUGCCCACCCCGGUG..GGAGCACUACU..........GUCGC
AL939123.1/7488-7321                 UCGCGUCCCCCGGCACAAGAUG..UAUGCUCAUGCUC........GCUGU
AJ295339.2/5-215                     GGCCCCCACAUGUAUGCUCGU...CCUCG................CUGUC
AL939107.1/147400-147583             CAGACCGUAGUAUCAGCGGGU...CAUCGCC...................
AY043208.1/560-782                   UAUCUUUGCUCCCUGAUCGGU...UCCGAAUA.............GUCAU
AE016934.1/49817-49625               AUUUUGCAGUCGGGAAAUGGU...UUCGGGAG.............GUUUA
AE016932.1/26373-26579               CUAUCUUUGUCGCGCAUUGGU...UUGCAACUCUCAUGC......ACGAG
AE016933.1/293262-293468             AUCUUUGCCCCCCGAAAUGGU...UCGGAGUCC............GUGUC
AE016934.1/101000-101187             AUCUUUGUAUCCGAUUUCGGAA..CUA..................AAAAG
AE016934.1/218065-217852             GUAUCUUUGCACCUGCAAGGU...UCGUAUUUGGAGUU.......GUCUA
AE016932.1/22310-22515               UAUCUUUGUCCCCGCAUUGGU...UUGCGACUCUC..........AUCAC
AE017174.1/111334-111550             CGUUUCUUUCAUGAAGACGGU........................GCA..
AE017174.1/95859-95679               UCUCCUCAUUUAUCGAGAGGUCAGUC...................GAAU.
AE017176.1/130222-129963             CUUUGUUCCCAUCGUAGUGGU...CCCUGCUCGUCUCGA......ACAAG
AE017174.1/143751-143548             UAUCUUUGCCGUGUCAAUGGUU..UUCUACACCGGUUC.......AUGGA
AE017176.1/287850-287663             GCUGCCUUUUUCCUAUUGGGA...UCGGUG...............GUGA.
BX569694.1/273573-273792             CCCCUAGGGUUUGGGUCUGGUU..UCAGCGGGG............AUCAG
AJ000758.1/1191-1370                 UCAAACAGCAACAGUAAAGGU...GCC..................AAGA.
AJ000758.1/1489-1668                 CAUAUCGUGCAAAAAAAAGGUG..CGUAAUAUUUA..........CAUU.
AE017011.1/46644-46832               CCUUUCAAAAGGAAAAUAGGU...ACACGAAA.............GUUUU
AE017037.1/59439-59627               CCUUUCAAAAGGAAAAUAGGU...ACACGAAC.............AUUUC
AE017277.1/42695-42883               CCUUUCAAAAGGAAAAUGGGU...ACACGAACA............GUUUG
AL596167.1/202425-202602             GUACUAAACAACUAAAUAGGU........................GAAU.
AL591978.1/56481-56658               GUACUAAACAACUAAAUAGGU........................GAAU.
AL591978.1/19809-19999               UUAAAUAGGUCUUAUGUUGGUG..GAAUGUAUGU...........ACAU.
AL596167.1/167425-167616             UUAAAUAGGUCUUAUGUUGGUG..GAAUGUGUUU...........GCAU.
AE015939.1/117645-117826             AAAUGUUUUAUGAAAAUAGGU...UUAAUA...............ACUU.
AE007648.1/1506-1693                 UUGCUACUAAAAUUUGUAGGU...UCAACUGAG............GAGUC
AE015938.1/141777-141949             UAUUCAGGUGCCAUUUUAGGU.............................
AE015940.1/273052-272875             AUUUAUAGAAUAAAUUUAGGU...GCU...................UAU.
AE015941.1/2960-3143                 CAUAUUAUGAAUUUUUAUGGU...GUA..................AUUUC
AE015940.1/279870-279682             UAAUAUAAUAAGACAACAGGU...UUGAAAUAAUAUUUAUU....AUUU.
AE007744.1/3364-3542                 AAAUAAUACCAUAUUUUAGGC...ACCUAAU..............CUUA.
AE015938.1/166402-166584             UUUAAUAUUAUUUUAUUAGGUG..CUUUAC....................
AE015938.1/219824-220006             UUAAAUAUUUAUUUAUAAAGU...UUCUUGU..............AAAA.
AE015938.1/165030-165211             AAUAAUAUGAAUAAAAAAGGU...GAAAUAG..............UUAU.
AE015938.1/189808-189620             AAUAGUAAAUGAAAUUUAGGUG..UCCACUUU.............GUAAA
AE015944.1/6900-6723                 AUUUAAUAUUAGAUUUUAGGU...GUG..................AUCUU
AE015938.1/189936-190117             GAAUAUUAAAAUUUAUAGAGUUA.CCC..................AUUU.
AE013010.1/3537-3777                 UGAAUAUUAAAGCCUUAUGGU...CCC..................AUGAU
AE013011.1/30-270                    GAAUAUAAAAAGCCUUAUGGU...CCC..................GUGAU
AE016952.1/63114-62943               ACGAAGAUACAAUAUAUAUGU...ACUU.................AUGA.
BX294140.1/211185-211419             UCCGAGGUGACUGAUUUGGUUU..CUGCC................GAGU.
BX294144.1/76053-76292               GCAACGUUACGUGGUGCCGGU...GUUCCAAAUCUUGG.......AUCAC
AE005721.1/1901-2129                 GUCUGUUGCCGUUGUCGUGGU...CUGCGGAC.............GUUCG
AE005849.1/870-1059                  AGCUCUAGCUUCGCGUCAGGU...UCCUC................GAAA.
AF306632.1/382-181                   GAUAAUCCAAGUCGUCGAGGUU..CUCCGGUUCCC..........AUUGA
BX572599.1/256535-256331             CAAACAUCGCGCGCCGACGGUG..UCCUGUCUUCG..........GACA.
BX572595.1/86162-86360               GCUAGCGUGCCAAGCGAUGGU...CCUUCC...............GUCA.
BX572608.1/190529-190732             ACUUCUAAUGGCGGUGACGGU...UCCCG................AGAG.
BX572599.1/247113-247314             UUAACCCGAGGUUGUACCGGUG..CCUCUCG..............CCGA.
BX572596.1/50556-50756               UCUGGUUUUGACGUCUUCGGUG..CCUC.................GCGU.
BX572595.1/100553-100338             UUUGAUCGCGCCCGUUCAGGU...GUGCCGG..............GAAUC
BX572600.1/273933-274129             CAUAGUGAUCGCCGUCGAGGUU..CUUCGGGCACG..........AUCGU
BX572599.1/259196-259407             UGUGGUGCCGCUCGCUUCGGUG..CCCUUCGUU............CGAA.
BX572594.1/100625-100429             AAUACCGUGACCAGCGACGGU...UCCCG................AAAG.
AE009726.1/9564-9351                 ACCAUAUCUUGUGUUCGAGGUU..CUUUCGAUUC...........GACGA
AL672113.1/43141-43341               UGAUUGUGCGCAUGUCGUGGUU..CUCCGCGCGG...........CACUG
U45329.1/408-194                     CUAAAGUGGCAGCGUAUCGGU...UCUGCAAGUGUC.........AAAAC
AE009122.1/6687-6504                 CCAUAGCUUCUCCGGUCAGGUG..CCCGC................CCUUG
AE008342.1/7843-8078                 CUUAUGUGAGAAAGCGACGGU...UCCUACAGCC...........GAAAG
AE008981.1/4074-4298                 ACUAUAUGUGGUGUUCAAGGUU..CUUCCGAUUC...........GCUAG
AE008300.1/11923-11714               ACAUUGGUUAGCCAUCGUGGUU..CUGCGGAC.............GAAGG
AE009228.1/1838-1621                 UAAGGGUAAGGGACUGACGGU...CUUUUCCCG............GCAAC
AE009054.1/2448-2676                 GGAUAACAUGUCCGUGAUGGUU..CCUUCCGG.............GCGUU
AL591785.1/88210-88413               UUAGAUGAGGACACUCAAGGUG..CCGCCUCG.............AAGGG
AL591789.1/35311-34896               AAUUAACGCAGUAUGGAUGGU...UCUCUCGUGCCGAG.......GUGGG
AL591788.1/218367-218154             GGCCAUAUGCCGCCGUCAGGUG..CCCGCG...............AAAU.
AF010496.1/116971-117194             GCUACUCCAACAGGCGAUGGU...UCCC.................AACUG
AF010496.1/105318-105541             CCACUCAGGGCGGGCGCUGGUU..UCUGUC...............CUAU.
AF010496.1/39869-39652               GGCACCUUCGCGGCAGAUGGUU..CCCGGCCAA............GCCAC
AF193754.1/24966-24788               GGAAAUUUUUUUGCAUAGGGU...UUCCUUCGA............GUGA.
AF193754.1/4343-4142                 GCAAUGAGGAAGGAUUAAGGUU..CUUUG................UCAUU
AL646079.1/157144-156965             AUCCCGCCUCACGAUGAUGGUG..CCCUUC....................
AL646070.1/4253-3997                 UUACACUCGCCGCGUCCUGGUG..CCCGCAGA.............GCCGA
AE016915.1/175048-174863             AUUCUUGCCAUUCUUGACGGUG..CCCC.................AAAA.
AE016911.1/218236-218501             AUAAUCCGACGAUUCGCAGGUG..UCCGCAGCCGC..........GCAGC
BX321858.1/81804-81577               UCUGCGCCCCUUGUUUGAGGUG..UCCCAGAUGC...........AUUUG
AE015548.1/1057-1279                 CCUAUGCUAUUGCAUUAAGGUC..AUAAACGCCGG..........AUCAA
AE015526.1/127-357                   UUUGAGUCAACCUUCUGUGGUG..CUUGCGAU.............GAUAG
M10112.1/56-247                      CUGUAGCAUCCACUUGCCGGUC..CU...................GUG..
AE016770.1/161998-162188             CUGUAGCAUCCACUUGCCGGUC..CU...................GUG..
AJ278144.1/22351-22163               CAGUAAUAUCCAGUUGUCGGU...CCUGC.....................
BX571869.1/30799-30632               UUAAUACCACACCUUAAUGGU........................GUGG.
M57569.1/218-26                      CGGUAGCAUCCGUGGGCCGGUC..CU...................GUG..
L12006.1/1016-1191                   CCAUAACGUAAACCAACAGGUUU.GCCAC................AUUU.
M89481.1/311-504                     CGGUAGCAUCCGUGGGCCGGUC..CU...................GUG..
AL627279.1/139350-139157             CGGUAGCAUCCGUGGGCCGGUC..CU...................GUG..
AE008893.1/4980-5173                 CGGUAGCAUCCGUGGGCCGGUC..CU...................GUG..
AE016990.1/90583-90393               CUGUAGCAUCCACUUGCCGGUC..CU...................GUG..
AJ414159.1/142249-141989             UCGUAGCAUUGUGGU.CCGGC...CUCAUGCU.............GUUAU
M34485.1/360-150                     UUUACACAAUUCGUAACAAGUU..AAA..................AGCAU
AE004721.1/1492-1697                 CCUAGGCGGGUUGUCCCAGGUG..UCUCGUGCC............GGCGC
AE016783.1/50062-49864               UCUACCAUGCGGGCCGCCGGU...UUCCAC...............CACG.
AE004721.1/1433-1242                 GUAGCCUUGCCGGUUCGAGGUU..CCUCGCCG.............GCGAC
AE016783.1/53812-53604               AGAUGCGCGCCAGUUUCAGGUG..CCCUGCGCC............GCCGC
AE016787.1/55358-55152               GUAGCCUUGCCACUUCGAGGUU..CUUCG................GCCUG
AE016786.1/232051-232274             CCUUAUGCCUCGCGUUCAGGUG..CCC..................CUCA.
AE004716.1/11608-11412               GGGCCGAAGAGGGAACACGGA...GCCGC.....................
AE004717.1/4221-4426                 CCCAUCCGGCCCGUUCCAGGUG..CCUCCUGCC............GCCGC
AE016780.1/58096-58317               CCUUCGCGGCGUGUUUCAGGUG..CCCUGCCAGCCCC........GACUG
AE016800.1/261827-262025             UAGUAUGCGCUUCAAGCUGGU...GCUAUCUG.............GAAGU
AE004105.1/5235-5438                 UACUAUCAGCGCCAAGCUGGU...GCUAUUUAGAUGCCUG.....GAUGG
AE012421.1/6485-6262                 UACCAUGCGCGCCCCUGAGGUG..ACUGCCGG.............AAUUC
AE011604.1/13614-13434               GCACAGUUUUUUCAUAGGGUU...UAUCU................AUGUU
AE011315.1/3428-3605                 UGGAACGGAAAACUUGUUUAU...UCUCGUG..............AUGA.
AE017248.1/199120-198939             CAAUUUUCAAACCAUACAGGUG..CCGA.................GAUU.
AE017249.1/124649-124462             AAUAACGGUUUCGGUCUUGGUG..CUCCUU...............UUAGC
AE017252.1/282498-282294             AAGGUUAUAGACAAAUAAGGU...UCUUAAAU.............UAAUU
AK109157.1/8-245                     CAGGUGCCCAGCCGUUUCGGU...UC...................AGGAA
U27616.3/1255-1032                   UCGCUCGCUUCAGGAAACGGU...UCUGCC...............CGAGA
#=GC SS_cons                         ...............<<<<<<...<<<.......................

BX248357.1/28572-28772               .........GAACUGCU..GC.AU.GGGAA.U.CU.GGUGA.........
BX248356.1/172244-172444             ........UGUUGAAGU..GA.UC.GGGAA.UGCC.AGUGC.........
Z94723.1/23034-23246                 ..........GCAUCGC..GA.GA.GGGAA.C.CC.GGUGA.........
AL583923.1/215513-215333             G.......GCGAUGACG..AU.GC.AGGAA.G.UC.GGUGC.........
AE017236.1/265189-265430             ............CGU....AA.GA.GGGAA.C.CC.GGUGA.........
AE017236.1/188845-189025             ........GUGAUGACG..AU.GC.AGGAA.G.CC.GGUGC.........
BX842572.1/309867-309685             ........GCGAUGACG..AU.GC.AGGAA.G.CC.GGUGA.........
BX248337.1/276050-275850             ............GAG........A.GGGAA.C.CU.GGUGA.........
BX248334.1/308192-308010             ........GCGAUGACG..AU.GC.AGGAA.G.CC.GGUGA.........
AY033236.1/563-353                   ........CAGUCGUCGC.AA.GA.GGGAA.U.CC.GGUGU.........
AY033235.1/252-496                   ........GCGCGUCCGC.....A.GCGAA.G.CC.GGUGG.........
AL939130.1/261334-261631             G.......AAGCGCCUC..GU.GG.GGGAA.GUCC.GGUCG.........
AL939107.1/140625-140436             ........GACGGUCC.......G.AGGAA.G.CC.GGUGC.........
AL939107.1/133849-134073             GCG.....GGAUGCGUCGCAA.GA.GGGAA.C.CC.GGUGG.........
AL939110.1/156680-156867             ........CGGCGGCAG..AA.GA.GG.AA.GCCC.GGUGC.........
AL939107.1/141879-142126             GGC.....GGCGCGACGC.AA.GA.GGGAA.C.CC.GGUGG.........
AF263012.1/9229-9015                 G.......CAGGGUGUCGCAA.GA.GGGAA.C.CC.GGUGG.........
AL939125.1/243385-243171             CA......CGCCUUGGU..GA.AC.GGGAA.AUCC.GGUGU.........
AL939123.1/7488-7321                 ........CGCCGCA........G.GGGAA.U.CC.GGUGC.........
AJ295339.2/5-215                     G.......UCGCAGG...........GGAA.U.CC.GGUGG.........
AL939107.1/147400-147583             .........GCGACGGG..AG.AC.AGGAA.G.CC.GGUGU.........
AY043208.1/560-782                   UCCUCU..AUCCGGAUU..AA.AA.GGGAA.U.CG.GGUGU.........
AE016934.1/49817-49625               CGCC....UUCCGAAUG..AA.AA.GGGAA.C.CC.GGUGA.........
AE016932.1/26373-26579               G.......GAAGCAAUU..AA.AA.GGGAA.U.CA.GGUGA.........
AE016933.1/293262-293468             CAACGG..ACAACGAUU..AA.AA.GGGAA.U.CG.GGUGU.........
AE016934.1/101000-101187             A.......GGUUUAGUC..AAUGA.GGGAA.C.GC.UGUGC.........
AE016934.1/218065-217852             ACCUUCC.AAAACGAUG..AA.AA.GGGAA.U.CC.GGUGU.........
AE016932.1/22310-22515               GAGG....GAAGCGAUU..AA.AA.GGGAA.U.CA.GGUGU.........
AE017174.1/111334-111550             .......................A.GGGAA.U.CC.GGUGC.........
AE017174.1/95859-95679               .............GAUU..AA.AA.GAGAA.U.UU.GGUGC.........
AE017176.1/130222-129963             CUG.....AGUGGGGUGU.AA.GA.GGGAA.U.CG.GGUGA.........
AE017174.1/143751-143548             G.......UGUAGAAUG..AA.AA.GGGAA.C.CC.AGUGA.........
AE017176.1/287850-287663             ............UGAUU..AA.AA.GGGAA.U.CG.GGUGA.........
BX569694.1/273573-273792             ........CCGCUGAUGG.AA.ACGGGGAAAGAAC.GGUGC.........
AJ000758.1/1191-1370                 ...........AGGCUU..AA.UA.GGGAA.A.CU.GGUGA.........
AJ000758.1/1489-1668                 ............GCGUU..AA.AU.GGGAA.GUCU.GGUGU.........
AE017011.1/46644-46832               GU......UUCGUGUUU..AA.AA.GGGAA.GCUU.GGUGA.........
AE017037.1/59439-59627               GU......UUCGUGUUU..AA.AA.GGGAA.GCUU.GGUGA.........
AE017277.1/42695-42883               U.......UUCGUGUUU..AA.AA.GGGAA.GCUU.GGUGA.........
AL596167.1/202425-202602             .........AUA...UU..AA.UCCGGGAA.A.GA.GGUGG.........
AL591978.1/56481-56658               .........AUA...UU..AA.UCCGGGAA.A.GA.GGUGA.........
AL591978.1/19809-19999               ............UUCUG..AA.AG.AGGAA.U.UC.GGUGC.........
AL596167.1/167425-167616             ............UUCUG..AA.AG.AGGAA.U.UC.GGUAU.........
AE015939.1/117645-117826             ............UAAUU..AA.AA.GGGAA.GUUG.GGUGA.........
AE007648.1/1506-1693                 U.......UAGUUGAUU..AA.AA.AGGAA.U.CA.GGUGA.........
AE015938.1/141777-141949             ...............UU..AA.AA.GGGAA.U.GU.GGUUU.........
AE015940.1/273052-272875             ............AGCUU..AA.UA.GGGAA.G.CA.GGUGA.........
AE015941.1/2960-3143                 ........ACAUUACGU..AA.AA.GGGAA.G.CUUGGUGU.........
AE015940.1/279870-279682             ............CAAUU..AA.AA.GGGAA.A.CA.GGUGU.........
AE007744.1/3364-3542                 ............GGUUU..AA.UA.GGGAA.A.UU.GGUGA.........
AE015938.1/166402-166584             ............AAGUU..AA.AA.GGGAA.A.GU.GGUGA.........
AE015938.1/219824-220006             ..........GAGAAUU..AA.AA.GGGAA.G.GA.GGCGA.........
AE015938.1/165030-165211             ............UUCUU..AA.AA.GGGAA.GCAU.GGUGA.........
AE015938.1/189808-189620             AA......UGAUGGAUG..AA.AA.GGGAA.U.GU.GGUUC.........
AE015944.1/6900-6723                 A.......UAAUUACUU..AA.AA.GAGAA.A.GU.GGUGA.........
AE015938.1/189936-190117             .........UUGGGGUU..AA.AA.GGGAA.G.GG.GGUUA.........
AE013010.1/3537-3777                 ............GGGUU..AA.AA.GGGAA.GACG.GGUGA.........
AE013011.1/30-270                    ............GGGUU..AA.AA.GGGAA.GACG.GGUGA.........
AE016952.1/63114-62943               ............AGUGUC.....A.GGGAA.A.GA.GGUGC.........
BX294140.1/211185-211419             ............CAGUG..AA.CA.GGGAA.CUCC.GGUGA.........
BX294144.1/76053-76292               ........UGGGAAC........A.GGGAA.CUUC.GGUGA.........
AE005721.1/1901-2129                 CG......UCCGGAGCU..AA.GA.GGGAA.G.UC.GGUGAGGGCGUGAA
AE005849.1/870-1059                  ..........GAGGAUG..AA.AA.GGGAA.C.GA.GGUUG.........
AF306632.1/382-181                   ........UCCGGAGCU..AA.GA.GGGAA.G.CC.GGUGC.........
BX572599.1/256535-256331             ............GGACG..AA.GA.GGGAA.UAUC.GGAAGAUCGCUGCC
BX572595.1/86162-86360               .........GGAAGGUG..AA.AA.GGGAA.G.CC.GGUGGGAGGCGCGG
BX572608.1/190529-190732             ............GGAUG..AA.AA.GGGAA.U.AC.GGUGCGGACGCAGA
BX572599.1/247113-247314             .........GAGAGGUG..AA.AC.GGGAA.U.GC.GGUGCGGGGCGAUG
BX572596.1/50556-50756               .........GCGAGGUG..AA.ACUGGGAA.U.AC.GGUGCGGUGUUUUU
BX572595.1/100553-100338             GU......CCGGCAC........A.GGGAA.G.CC.GGUGCGGGCCCAAG
BX572600.1/273933-274129             ........CCCGAAGCU..AA.GA.GGGAA.G.CC.GGUGC.........
BX572599.1/259196-259407             ............GGGUG..AA.AC.GGGAA.U.GC.GGUGCGGCGAGCAA
BX572594.1/100625-100429             ............GGAUC..AA.UA.GGGAA.C.GC.GGUGCGGGCUUUAG
AE009726.1/9564-9351                 G.......UCGGGAGCU..AA.GACGGGAA.U.CC.GGUGCGCUUGCCCA
AL672113.1/43141-43341               CCGU....AGCGGAGCU..AA.GA.GGGAA.G.CC.GGUGC.........
U45329.1/408-194                     GC......NCGCGGAUG..AA.AA.GGGAA.U.AC.GGUGAGGACGACCC
AE009122.1/6687-6504                 ........CGGCGGGAG..AA.UC.GGGAA.U.CC.GGUGA.........
AE008342.1/7843-8078                 GC......GAAGGGAUU..AA.UA.GGGAA.C.AU.GGUGCGGGCGAUCU
AE008981.1/4074-4298                 GG......UUGGGAGCU..AA.GACGGGAA.U.UC.GGUGCGUAACGCCA
AE008300.1/11923-11714               ........UCCGGAGCU..AA.GA.GGGAA.U.UC.GGUGAGGGCUUUAA
AE009228.1/1838-1621                 G.......GGAAAAGCU..AA.GA.GGGAA.C.AC.GGUUCCGCCCCGAG
AE009054.1/2448-2676                 C.......CGGAAGGUG..AA.AA.GGGAA.C.AC.GAUAGGGACAAAUC
AL591785.1/88210-88413               ........AGGGCGGAG..AA.UU.GGGAA.G.CC.GGUCA.........
AL591789.1/35311-34896               G.......CGAGGGAGU..AA.AU.GGGAA.U.GC.GAAGGGGCGGACCC
AL591788.1/218367-218154             ..........GCGGGGG..AA.UC.GGGAA.G.CC.GGUGC.........
AF010496.1/116971-117194             ........GACGGGAUU..AA.UA.GGGAA.C.AC.GGUGAGGAUUACCC
AF010496.1/105318-105541             .........GACAGGCG..AA.GA.GGGAA.U.GU.GAAGGGAAUUGCGA
AF010496.1/39869-39652               GCGC....GGCCGGGUG..AA.AA.GGGAA.U.AC.GGUGUGGUGUAGGC
AF193754.1/24966-24788               ..........AGGAA....AA.UU.GGGAA.C.AA.GGUGC.........
AF193754.1/4343-4142                 ........GGCAAAGCU..AA.GA.GGGAA.A.CU.GGUGCGAAAGAAUU
AL646079.1/157144-156965             ..........CAGGGUG..AA.AC.GGGAA.C.GC.GGUGC.........
AL646070.1/4253-3997                 ........UCUGCAGUU..AA.AC.GGGAA.G.CA.GGGAGCGGCCGCCC
AE016915.1/175048-174863             ............GGGUG..AA.AC.GGGAA.C.GC.GGUGG.........
AE016911.1/218236-218501             CACGCGC.GGGCGGAUG..AA.AC.GGGAA.G.CC.GGUGC.........
BX321858.1/81804-81577               CA......CGAGGGAUG..AA.AC.GGGAA.G.CC.GGUGCGCGCUGGAA
AE015548.1/1057-1279                 ........CCCAAAUAU..AA.UA.GGGAA.U.CG.GGGCGCUGCCCGUC
AE015526.1/127-357                   CG......UCGCGAGAU..AA.UC.GGGAA.G.CC.AGUGA.........
M10112.1/56-247                      .............AGUU..AA.UA.GGGAA.U.CC.AGUGC.........
AE016770.1/161998-162188             .............AGUU..AA.UA.GGGAA.U.CC.AGUGC.........
AJ278144.1/22351-22163               ............GAGUU..AA.UA.GGGAA.U.CC.AGUGC.........
BX571869.1/30799-30632               ...............U.......U.GGGAA.G.GA.GGUGA.........
M57569.1/218-26                      .............AGUU..AA.UA.GGGAA.U.CC.AGUGA.........
L12006.1/1016-1191                   ..........GUGGU........A.GGGAA.G.GG.GGUGA.........
M89481.1/311-504                     .............AGUU..AA.UA.GGGAA.U.CC.AGUGA.........
AL627279.1/139350-139157             .............AGUU..AA.UA.GGGAA.U.CC.AGUGA.........
AE008893.1/4980-5173                 .............AGUU..AA.UA.GGGAA.U.CC.AGUGA.........
AE016990.1/90583-90393               .............AGUU..AA.UA.GGGAA.U.CC.AGUGC.........
AJ414159.1/142249-141989             UUAAACACCUAAGAGUU..AA.AA.GGGAA.U.CC.GGUGU.........
M34485.1/360-150                     ........UCGCUUU........A.GGGAA.A.CU.GGUGC.........
AE004721.1/1492-1697                 G.......CACGAGGUG..AA.AC.GGGAA.G.CC.GGUGACGCUCUCCG
AE016783.1/50062-49864               ............GAACU..AA.CA.GGGAA.U.CC.CAGGCCUGCCAAUA
AE004721.1/1433-1242                 ........GGCGGGGCU..AA.GA.GGGAA.C.GC.GGUC..........
AE016783.1/53812-53604               G.......CGCAGGGUG..AA.AC.GGGAA.A.CC.GGUGCGUCGUGUUG
AE016787.1/55358-55152               ........GCCGAAGCU..AA.GACGGGAA.C.GC.GGUAC.........
AE016786.1/232051-232274             ..........GGGGGUG..AA.AC.GGGAA.A.CC.GGUGCGUCCCAGGC
AE004716.1/11608-11412               ............GGUCUU.....U.UCGAA.G.CC.CGGGC.........
AE004717.1/4221-4426                 G.......CAGGAGGUG..AA.AC.GGGAA.G.CC.GGUGCGUCACUUCG
AE016780.1/58096-58317               ........GGCAGGGUG..AA.ACUGGGAA.G.CC.GGUGGGCGCCAGCA
AE016800.1/261827-262025             AU......AGAUGGCUG..AA.AA.GGGAA.U.CC.GGUGU.........
AE004105.1/5235-5438                 CUAA....AAAUGGCUG..AA.AA.GGGAA.U.CC.GGUGU.........
AE012421.1/6485-6262                 ........CGGUGGUUU..AA.AC.GGGAA.U.CC.GGUGCGCGCAUCGC
AE011604.1/13614-13434               ........UCACAUA....GA.UA.G.GAA.G.AC.GGUUA.........
AE011315.1/3428-3605                 ............GGA........A.GGGAA.U.CC.GGUUC.........
AE017248.1/199120-198939             ............CGGUU..AA.AA.GGGAA.GCAC.GGUGU.........
AE017249.1/124649-124462             ........UAAGGAGUG..AA.AA.GGGAA.U.CA.GGUGA.........
AE017252.1/282498-282294             ........UUUAAGAUU..AA.AA.GGGAA.A.CC.GGUGA.........
AK109157.1/8-245                     C.......GGCG.GGUU..CA.AC.GGGAA.G.CC.GGUGAGCGCAAGGC
U27616.3/1255-1032                   ........GGGUGGAUG..AA.AA.GGGAA.C.AC.GGUGAAGCAUUAAA
#=GC SS_cons                         ............>>>........<.<<....<.<<.<<............

BX248357.1/28572-28772               ..................AAAU.CCAG.AGCUGA.C.GC..GCAGCGGUG
BX248356.1/172244-172444             ..................AAUU.CUGGCAGCGGACC.CC..GCCACUGUA
Z94723.1/23034-23246                 ..................GAAU.CCGG.GACUGU.C.CC..GCAGCGGUA
AL583923.1/215513-215333             ..................AAAG.CCGG.CGCGGU.C.CC..GCCACUGUA
AE017236.1/265189-265430             ..................GAAU.CCGG.GACUGU.C.CC..GCAACGGUA
AE017236.1/188845-189025             ..................GAAU.CCGG.CGCGGU.C.CC..GCCACUGUC
BX842572.1/309867-309685             ..................GAAU.CCGG.CGCGGU.C.CC..GCCACUGUC
BX248337.1/276050-275850             ..................GAAU.CCGG.GACUGU.C.CC..GCAGCGGUA
BX248334.1/308192-308010             ..................GAAU.CCGG.CGCGGU.C.CC..GCCACUGUC
AY033236.1/563-353                   ..................AAUU.CCGG.AACUGU.C.CC..GCAGCGGUC
AY033235.1/252-496                   ..................GAAU.CCGG.CGCUGU.C.CC..GCAACGGUG
AL939130.1/261334-261631             ..................AAGU.CCGG.CGCUGA.C.CC..GCAACGGUA
AL939107.1/140625-140436             ..................GAAU.CCGG.CGCGGU.C.CC..GCCACUGUG
AL939107.1/133849-134073             ..................GAAU.CCGG.GACUGC.C.CC..GCAGCGGUG
AL939110.1/156680-156867             ..................GAAU.CCGG.CGCGGU.C.CC..GCCACUGUG
AL939107.1/141879-142126             ..................GAAU.CCGG.GACUGU.C.CC..GCAGCGGUG
AF263012.1/9229-9015                 ..................AAAU.CCGG.GACUGC.C.CC..GCAGCGGUG
AL939125.1/243385-243171             ..................GAUG.CCGG.UGCGGCCC.UC..GCCACUGUG
AL939123.1/7488-7321                 ..................GAAU.CCGG.AACUGU.C.CC..GCAACGGUG
AJ295339.2/5-215                     ..................AAAU.CCGG.AACUGU.C.CC..GCAACGGUA
AL939107.1/147400-147583             ..................GAAU.CCGG.CACGGU.C.CC..GCCACUGUG
AY043208.1/560-782                   ..................AAAU.CCCG.GACAGU.C.CC..GCUGCUGUG
AE016934.1/49817-49625               ..................AAAU.CCGG.GACAGUAC.CC..GCUGCUGUG
AE016932.1/26373-26579               ..................AAGU.CCUG.AACAGU.C.CC..GCUGCUGUA
AE016933.1/293262-293468             ..................AAAU.CCCG.UACAGU.C.CC..GCUGCUGUG
AE016934.1/101000-101187             ..................AAAU.CGGC.GACAGUAC.CC..GCUGCUGUA
AE016934.1/218065-217852             ..................AAAU.CCGG.GACAGUAC.CU..GCUGCUGUA
AE016932.1/22310-22515               ..................AAAU.CCUG.AACAGU.C.CC..GCUGCUGUA
AE017174.1/111334-111550             ..................AAUU.CCGG.AGCUGAGC.CC..UCAGCUGUA
AE017174.1/95859-95679               ..................AAAG.CCAA.AACUAUCC.CC..GUAGCCGUA
AE017176.1/130222-129963             ..................GAAU.CCCG.AGCAGU.C.CC..GCUGCUGUA
AE017174.1/143751-143548             ..................AAUU.CUGG.GACUGUAC.CC..UCAGCUGUA
AE017176.1/287850-287663             ..................AAAU.CCCG.AGCAGU.C.CC..GCUGCUGUG
BX569694.1/273573-273792             ..................AAAU.CCGU.CGCUGU.C.CC..GCAGCUGUA
AJ000758.1/1191-1370                 ..................AAGA.CCAG.UACUGCCC.CC..GCAACUGUA
AJ000758.1/1489-1668                 ..................GAAG.CCAG.CGCGUA.C.CC..GCCACUGUG
AE017011.1/46644-46832               ..................AACU.CCAA.CACGGU.C.CC..GCCACUGUA
AE017037.1/59439-59627               ..................AACU.CCAA.CACGGU.C.CC..GCCACUGUA
AE017277.1/42695-42883               ..................AACU.CCAA.CACGGU.C.CC..GCCACUGUA
AL596167.1/202425-202602             ..................AAAU.CCUC.UACAGGCC.C.UAGCUACUGUA
AL591978.1/56481-56658               ..................AAAU.CCUC.UACAGGCC.C.UAGCUACUGUA
AL591978.1/19809-19999               ..................GAUG.CCGA.AACUGCCC.CC..GCAACUGUA
AL596167.1/167425-167616             ..................GAAG.CCGG.AACUGCCC.CC..GCAACUGUA
AE015939.1/117645-117826             ..................AAAU.CCCA.CGCGGU.A.CC..GCCGCUGUA
AE007648.1/1506-1693                 ..................AAAG.CCUG.AGCGGU.C.CC..GCCACUGUA
AE015938.1/141777-141949             ..................AAUU.CCAC.AGCAGCCC.CC..GCUACUGUA
AE015940.1/273052-272875             ..................AAAU.CCUG.AACGGU.C.CC..GCCGCUGUG
AE015941.1/2960-3143                 ..................AAAU.CCAG.CACGGU.C.CC..GCCACUGUA
AE015940.1/279870-279682             ..................AACU.CCUG.UACGGU.C.CC..GCCGCUGUA
AE007744.1/3364-3542                 ..................AAAU.CCAA.UGCAACCC.CC..GUUACUGUA
AE015938.1/166402-166584             ..................AAAU.CCAC.UGCAGCCCACC..GUUACUGUA
AE015938.1/219824-220006             ..................AAAU.CCUC.CACGGU.C.CG..GCCACUGUA
AE015938.1/165030-165211             ..................AAAU.CCAU.CACGGU.C.CC..GCCACUGUA
AE015938.1/189808-189620             ..................AAUU.CCAC.AGCAGCCC.CC..GCUACUGUA
AE015944.1/6900-6723                 ..................AAAU.CCAC.UACAGCCC.CC..GCUACUGUA
AE015938.1/189936-190117             ..................GAAU.CCUC.CACGGU.C.CG..GCCACUGUA
AE013010.1/3537-3777                 ..................GAAU.CCCG.CGCAGCCC.CC..GCUACUGUG
AE013011.1/30-270                    ..................GAAU.CCCG.CGCAGCCC.CC..GCUACUGUG
AE016952.1/63114-62943               ..................GAAU.CCUC.UACAGACC.UA..CCUACUGUA
BX294140.1/211185-211419             ..................AAUU.CCGG.GACGGU.C.CG..GCCGCUGUG
BX294144.1/76053-76292               ..................GAUU.CCGA.GACGGC.C.CG..GCCGCUGUA
AE005721.1/1901-2129                 ACCCU.............GAAU.CCGG.CGCUGCCC.CC..GCAACUGUG
AE005849.1/870-1059                  ..................AAGA.CCUC.GGCUGCCC.CC..GCAACUGUA
AF306632.1/382-181                   ..................AAAUGCCGG.CGCUGC.C.CC..GCAACUGUA
BX572599.1/256535-256331             UGCAGCGGU.........CGCG.CCGA.AGCUGCCC.CC..GCAACUGUA
BX572595.1/86162-86360               UGCGUCUC..........GAUC.CCGG.AGCUGCCC.CC..GCAACUGUA
BX572608.1/190529-190732             CACUUUCGCGUUC.....UAGG.CCGU.AGCUGUUC.CC..GCAACUGUA
BX572599.1/247113-247314             CCCC..............AAUG.CCGC.AGCUGCCC.UC..GCAACUGUG
BX572596.1/50556-50756               CACC..............UAAU.CCGU.AGCUGCCC.CC..GCAACUGUA
BX572595.1/100553-100338             CUUAUGGCCGCAAACCC.AAAU.CCGG.CGCUGCGC.CC..GCAACUGUG
BX572600.1/273933-274129             ..................AAGG.CCGG.CGCUGCCC.CC..GCAACUGUU
BX572599.1/259196-259407             UCGCC.............AAGU.CCGC.GGCUGCCC.CC..GCAACUGUA
BX572594.1/100625-100429             GGCUC.............UAUU.CCGC.GGCUGCCC.CC..GCAACUGUA
AE009726.1/9564-9351                 UGGUGGGCGGGC......AAUG.CCGG.AGCUGCCC.CC..GCAACUGUA
AL672113.1/43141-43341               ..................GAUG.CCGG.CGCUGCCC.CC..GCAACUGUU
U45329.1/408-194                     AAGUAAGGGCC.......GAAA.CCGU.GGCUGCCC.CC..GCAACUGUG
AE009122.1/6687-6504                 ..................AAGA.CCGG.AACGUG.C.CC..AACGCUGUA
AE008342.1/7843-8078                 UUUUCGUCC.........AAUG.CCUU.GGCUGCCC.CC..GCAACUGUA
AE008981.1/4074-4298                 UCACGGCGGAGC......AAGG.CCGA.AACUGCCC.CC..GCAACUGUG
AE008300.1/11923-11714               UCACAGCCU.........GAAU.CCGA.AGCUGCCC.CC..GCAACUGUA
AE009228.1/1838-1621                 AAAGGGU...........CAUU.CCGU.GGCUGCCC.CC..GCAACUGUA
AE009054.1/2448-2676                 C.................UCAU.UCGU.GGCUGCCC.CC..GCAACUGUG
AL591785.1/88210-88413               ..................AAUC.CCGG.CGCUGCCC.CC..GCAACGGUG
AL591789.1/35311-34896               ACGCCGGGCGCC......CUUA.UCGC.AGCCGACC.CC..GCGACUGUA
AL591788.1/218367-218154             ..................AGUU.CCGG.CACGUG.C.CC..AACGCUGUG
AF010496.1/116971-117194             AUCAGGGGCC........UAAU.CCGU.GGCUGCCC.CC..GCAACUGUG
AF010496.1/105318-105541             CGGCUUUGCCGCGAAAC.CCGA.CCGC.AGCCGCCC.CC..GCGACCGUG
AF010496.1/39869-39652               AUCAGCCGCC........AAAU.CCGU.AACUGCCC.CC..GCAACUGUA
AF193754.1/24966-24788               ..................AAAA.CCUU.GGCUGCCC.CU..GCAACUGUA
AF193754.1/4343-4142                 UUC...............AAAG.CCAG.UGCUGCCC.CC..GCAACUGUA
AL646079.1/157144-156965             ..................GAUG.CCGC.GGCUGCCC.CC..GCAACUGUA
AL646070.1/4253-3997                 CAAACGGUGCG.......CCAA.CCUG.CGCUGCCC.CC..GCAACGGUA
AE016915.1/175048-174863             ..................AAUG.CCGC.GGCUGCCC.CC..GCAACUGUA
AE016911.1/218236-218501             ..................AAGG.CCGG.CGCUGCCC.CC..GCAACGGUA
BX321858.1/81804-81577               UCAGCCAGCGC.......AAUG.CCGG.CACUGCCC.CC..GCAACGGUA
AE015548.1/1057-1279                 AG................CCAG.CCCG.AACUGUAC.CC..GCAACUGUG
AE015526.1/127-357                   ..................AAUU.CUGG.CACUGCCC.CC..GCAACGGUA
M10112.1/56-247                      ..................GAAU.CUGG.AGCUGA.C.GC..GCAGCGGUA
AE016770.1/161998-162188             ..................GAAU.CUGG.AGCUGA.C.GC..GCAGCGGUA
AJ278144.1/22351-22163               ..................AAAU.CCGA.AACUGA.C.AC..GCAGCGGUA
BX571869.1/30799-30632               ..................AAGU.CCUC.CGCAGCCC.CC..GCUGCUGUG
M57569.1/218-26                      ..................AAAU.CUGG.AGCUGA.C.GC..GCAGCGGUA
L12006.1/1016-1191                   ..................AAAU.CCCC.CGCAGCCC.CC..GCUGCUGUG
M89481.1/311-504                     ..................AAAU.CUGG.AGCUGA.C.GC..GCAGCGGUA
AL627279.1/139350-139157             ..................AAAU.CUGG.AGCUGA.C.GC..GCAGCGGUA
AE008893.1/4980-5173                 ..................AAAU.CUGG.AGCUGA.C.GC..GCAGCGGUA
AE016990.1/90583-90393               ..................GAAU.CUAG.AGCUGA.C.GC..GCAGCGGUA
AJ414159.1/142249-141989             ..................AAAU.CCGG.AGCUGA.C.GC..GCAGCGGUA
M34485.1/360-150                     ..................AAAU.CCAG.UGCUGCCC.CC..GCAACGGUA
AE004721.1/1492-1697                 AGC...............CAGU.CCGG.CGCUGCCC.CC..GCAACGGUA
AE016783.1/50062-49864               CAGG..............CCAA.UCGG.AACUGCCC.CC..GCAACUGUA
AE004721.1/1433-1242                 ..................GAUG.CCGC.GGCUGCCC.CC..GCAACUGUG
AE016783.1/53812-53604               CCCACGAC..........AAGU.CCGG.UGCUGCCC.CC..GCAACGGUA
AE016787.1/55358-55152               ...................AAG.CCGC.GGCUGCCC.CC..GCAACUGUA
AE016786.1/232051-232274             CCUUCAGCAGGGCCGGACAAUG.CCGG.UGCUGCCC.CC..GCAACGGUA
AE004716.1/11608-11412               ..................CUAG.CCGU.GGCUGCCC.CC..GCAACUGUA
AE004717.1/4221-4426                 GUGAU.............CAGU.CCGG.CGCUGCCC.CC..GCAACGGUA
AE016780.1/58096-58317               UGGCGC............GAUU.CCGG.CGCUGCCC.CC..GCAACGGUG
AE016800.1/261827-262025             ..................GAAU.CCGG.AACUGA.C.GC..GCAGCGGUA
AE004105.1/5235-5438                 ..................AACU.CCGG.AACUGA.C.GC..GCAGCGGUA
AE012421.1/6485-6262                 CUUGGCGAGACGC.....AAGU.CCGG.AGCUGCCC.CC..GCAACGGUG
AE011604.1/13614-13434               ..................AAAU.CCGU.CACGGUAU.CC..GCCGCUGUA
AE011315.1/3428-3605                 ..................AAAU.CCGG.AGCUGAAC.CC..GCAGCUGUA
AE017248.1/199120-198939             ..................AAUU.CCGU.CACGGU.C.CC..GCCGCUGUA
AE017249.1/124649-124462             ..................AAGU.CCUG.AGCAGU.C.CG..GCUGACGUA
AE017252.1/282498-282294             ..................AAAA.CCGG.CACAGCCC.CC..GCUACUGUA
AK109157.1/8-245                     GAAGAGCCUCGCGC....AAUU.CCGG.CGCUGCCC.CC..GCAACGGUC
U27616.3/1255-1032                   UUGCU.............GAUG.CCGA.GACUGCCC.CC..GCAACUGUA
#=GC SS_cons                         .......................>>>>.>..<<<.......>>>.<<<..

BX248357.1/28572-28772               AAGGUGCA..........................................
BX248356.1/172244-172444             A.CCGCAAAUU.......................................
Z94723.1/23034-23246                 U.GCAGGA..........................................
AL583923.1/215513-215333             A.UCGG............................................
AE017236.1/265189-265430             U.GCAGGA..........................................
AE017236.1/188845-189025             A.UCGG............................................
BX842572.1/309867-309685             A.CCGG............................................
BX248337.1/276050-275850             U.GCAGGA..........................................
BX248334.1/308192-308010             A.CCGG............................................
AY033236.1/563-353                   A.AUGG............................................
AY033235.1/252-496                   AUGGGGCCCGGCCC....................................
AL939130.1/261334-261631             G.GCGGAGCCCCGCAAGGGGUCCCGUGAGCCCGAUUACCCGCGGUGGU..
AL939107.1/140625-140436             A.UCGGU...........................................
AL939107.1/133849-134073             A.GCGGGA..........................................
AL939110.1/156680-156867             ACCGGGGAC.........................................
AL939107.1/141879-142126             A.GUGGGA..........................................
AF263012.1/9229-9015                 A.GUGGGA..........................................
AL939125.1/243385-243171             AAUCGGG...........................................
AL939123.1/7488-7321                 U.AC..............................................
AJ295339.2/5-215                     U.GGUUCGCGCUCUUUCGCGCGGCCGGAGUCC..................
AL939107.1/147400-147583             A.CCGG............................................
AY043208.1/560-782                   AAGCUCCGUC........................................
AE016934.1/49817-49625               A.GUCCACAA........................................
AE016932.1/26373-26579               A.GUUCAUUUU.......................................
AE016933.1/293262-293468             AAGCUCU...........................................
AE016934.1/101000-101187             A.UUCU............................................
AE016934.1/218065-217852             A.GUCCUCUCUUUCGGGAGA..............................
AE016932.1/22310-22515               A.GUUCCAUAGA......................................
AE017174.1/111334-111550             AUGCUUCGAUGUCACUUCUCCGAACAAGAGGUGAUG..............
AE017174.1/95859-95679               U.GGUCGU..........................................
AE017176.1/130222-129963             A.GCUUUU..........................................
AE017174.1/143751-143548             A.GUUCAGAUGU......................................
AE017176.1/287850-287663             A.ACCUUGU.........................................
BX569694.1/273573-273792             A.AGCGUCCGGCC.....................................
AJ000758.1/1191-1370                 A.GUGU............................................
AJ000758.1/1489-1668                 A.AGA.............................................
AE017011.1/46644-46832               A.AUGC............................................
AE017037.1/59439-59627               A.AUGC............................................
AE017277.1/42695-42883               A.AUGC............................................
AL596167.1/202425-202602             A.UUC.............................................
AL591978.1/56481-56658               A.UAC.............................................
AL591978.1/19809-19999               A.GGU.............................................
AL596167.1/167425-167616             A.GGUG............................................
AE015939.1/117645-117826             A.GAGAG...........................................
AE007648.1/1506-1693                 AUAAAG............................................
AE015938.1/141777-141949             A.UUGA............................................
AE015940.1/273052-272875             A.UGG.............................................
AE015941.1/2960-3143                 A.GAGA............................................
AE015940.1/279870-279682             AUAAA.............................................
AE007744.1/3364-3542                 U.ACAG............................................
AE015938.1/166402-166584             A.UGC.............................................
AE015938.1/219824-220006             A.UUGG............................................
AE015938.1/165030-165211             A.UCAGG...........................................
AE015938.1/189808-189620             A.UAGA............................................
AE015944.1/6900-6723                 A.UAG.............................................
AE015938.1/189936-190117             A.UUGG............................................
AE013010.1/3537-3777                 A.GGGA............................................
AE013011.1/30-270                    A.GGGA............................................
AE016952.1/63114-62943               U.GGUG............................................
BX294140.1/211185-211419             U.GCCGCCAGAGAUCUUCCAAG............................
BX294144.1/76053-76292               U.CCGAUGCGAAGUUGCUGACUUGGCAACUUCC.................
AE005721.1/1901-2129                 A.GCGGC...........................................
AE005849.1/870-1059                  A.GCGGC...........................................
AF306632.1/382-181                   A.GUGGC...........................................
BX572599.1/256535-256331             A.ACGG............................................
BX572595.1/86162-86360               A.GCGA............................................
BX572608.1/190529-190732             A.GCGGA...........................................
BX572599.1/247113-247314             G.GCGG............................................
BX572596.1/50556-50756               G.GCGGA...........................................
BX572595.1/100553-100338             A.GCGGU...........................................
BX572600.1/273933-274129             A.GCGGU...........................................
BX572599.1/259196-259407             A.GCGGA...........................................
BX572594.1/100625-100429             A.GCGGC...........................................
AE009726.1/9564-9351                 A.GCGGCG..........................................
AL672113.1/43141-43341               A.GCGG............................................
U45329.1/408-194                     A.ACGG............................................
AE009122.1/6687-6504                 A.GGCG............................................
AE008342.1/7843-8078                 A.GCGGA...........................................
AE008981.1/4074-4298                 A.GCGGC...........................................
AE008300.1/11923-11714               A.GCGAC...........................................
AE009228.1/1838-1621                 A.GCGG............................................
AE009054.1/2448-2676                 A.GCGG............................................
AL591785.1/88210-88413               G.UGGAGCG.........................................
AL591789.1/35311-34896               GAACGGUCAGGGUUCGCCAUCGGGCAUUUCGCCGGAUUUCAACGCGCUGC
AL591788.1/218367-218154             A.AGGG............................................
AF010496.1/116971-117194             A.GCGGC...........................................
AF010496.1/105318-105541             A.CCGG............................................
AF010496.1/39869-39652               A.GCGG............................................
AF193754.1/24966-24788               A.ACAG............................................
AF193754.1/4343-4142                 A.ACGG............................................
AL646079.1/157144-156965             A.GCGA............................................
AL646070.1/4253-3997                 A.GCGAACGCCGUCGAAGGCCGCGCUACCUCUGGCCAGAAGAGGGCGCGG
AE016915.1/175048-174863             A.GCGC............................................
AE016911.1/218236-218501             A.GGCCUGGUGCGUAGGCG...............................
BX321858.1/81804-81577               A.AUGAG...........................................
AE015548.1/1057-1279                 A.GUAGUUAAA.......................................
AE015526.1/127-357                   AAAGGUG...........................................
M10112.1/56-247                      A.GGAA............................................
AE016770.1/161998-162188             A.GGAA............................................
AJ278144.1/22351-22163               A.GGAA............................................
BX571869.1/30799-30632               A.UGC.............................................
M57569.1/218-26                      A.GGA.............................................
L12006.1/1016-1191                   A.UGC.............................................
M89481.1/311-504                     A.GGA.............................................
AL627279.1/139350-139157             A.GGA.............................................
AE008893.1/4980-5173                 A.GGA.............................................
AE016990.1/90583-90393               A.GGAA............................................
AJ414159.1/142249-141989             A.GGGGA...........................................
M34485.1/360-150                     A.AAAU............................................
AE004721.1/1492-1697                 A.GCGC............................................
AE016783.1/50062-49864               G.GUGC............................................
AE004721.1/1433-1242                 A.ACGG............................................
AE016783.1/53812-53604               A.GCGA............................................
AE016787.1/55358-55152               A.GCACCGA.........................................
AE016786.1/232051-232274             A.GCGA............................................
AE004716.1/11608-11412               U.GCAGCC..........................................
AE004717.1/4221-4426                 A.GCGA............................................
AE016780.1/58096-58317               G.AUGAGU..........................................
AE016800.1/261827-262025             A.UAGA............................................
AE004105.1/5235-5438                 A.GAGA............................................
AE012421.1/6485-6262                 G.GCGAG...........................................
AE011604.1/13614-13434               A.GAAG............................................
AE011315.1/3428-3605                 A.UCGCCGAA........................................
AE017248.1/199120-198939             A.GAGAA...........................................
AE017249.1/124649-124462             AGUGAGA...........................................
AE017252.1/282498-282294             A.UUG.............................................
AK109157.1/8-245                     A.GCGA............................................
U27616.3/1255-1032                   A.CCGGA...........................................
#=GC SS_cons                         ..<<<<............................................

BX248357.1/28572-28772               ......AGUGAGUGCUUCAAUGUA..........................
BX248356.1/172244-172444             ......AUGCCCAUUUCUA...............................
Z94723.1/23034-23246                 ......ACGACCGCCGUCUGGAA...........................
AL583923.1/215513-215333             ......GGAGCGACCCUCGUAG............................
AE017236.1/265189-265430             ......ACGACCGCCGUCACCA............................
AE017236.1/188845-189025             ......GGAGCGACCCUCAACG............................
BX842572.1/309867-309685             ......GGAGCGACCCUCGUAA............................
BX248337.1/276050-275850             ......ACGACCGCCGUCUUGGAAGUAGACAA..................
BX248334.1/308192-308010             ......GGAGCGACCCUCAUAA............................
AY033236.1/563-353                   ......GAACGACACAACGUAA............................
AY033235.1/252-496                   ......CGAGUCCGGUCGACUGUGGACGUGUC..................
AL939130.1/261334-261631             ......GAAGCCCCUGUCAAUCGCCGUGGACUGCGAGAGGUGCUGUGCAG
AL939107.1/140625-140436             ......GAGCGGAUCCCGAAGUU...........................
AL939107.1/133849-134073             ......ACGACCGCCGUCAUAC............................
AL939110.1/156680-156867             ......AGGAUCCCCGGGAGC.............................
AL939107.1/141879-142126             ......ACGAAAGCCGUCAACA............................
AF263012.1/9229-9015                 ......ACGACCGCCGUCAUAC............................
AL939125.1/243385-243171             ......AAGUCCGGCUCCGGCCCUGACGGGCA..................
AL939123.1/7488-7321                 ..........UUGCGUGCAUCC............................
AJ295339.2/5-215                     ......GAAGACCUGUGGACAG............................
AL939107.1/147400-147583             ......GGAGUGCACCCUUCGACAC.........................
AY043208.1/560-782                   ......UGAAUUUCCGAUAACAACUGUU......................
AE016934.1/49817-49625               ......AAACGGACAUCGAACUUUU.........................
AE016932.1/26373-26579               ......UUGGUUGCGAGCAAUCGACUUUAUA...................
AE016933.1/293262-293468             ......AUACAAUGUCUUAUUAAUGAACUAAUUUAUC.............
AE016934.1/101000-101187             ......CUGUGAAUCCGCACACUAU.........................
AE016934.1/218065-217852             ......UGAGUUUAUCACAUUCUUU.........................
AE016932.1/22310-22515               ......UAUGUUGCGAGCAAUCUACUCAAA....................
AE017174.1/111334-111550             ......GGGUGGAUAGUCAAUCGCGAUG......................
AE017174.1/95859-95679               ......ACCUGUCGCUACAGAACGAU........................
AE017176.1/130222-129963             ......ACCGCCGUGUCGGUUUUGACAUGCGGACUCUUGUCGCUUUCCAA
AE017174.1/143751-143548             ......AAGGGUUUUGCCACGAGAAA........................
AE017176.1/287850-287663             ......UAAGCUUUCGGCAUUUAUA.........................
BX569694.1/273573-273792             ......CCGCCGGCGUCAGUCAG...........................
AJ000758.1/1191-1370                 ......GGACGAACGAGUAUA.............................
AJ000758.1/1489-1668                 ......GGAGCUGAUUGCAUUU............................
AE017011.1/46644-46832               ......UGAGAUUUCUUUUUGGU...........................
AE017037.1/59439-59627               ......UGAGAUUUCUUUUUGAU...........................
AE017277.1/42695-42883               ......UGAGAUUUCUUUUUAAU...........................
AL596167.1/202425-202602             ......GGACGAAAGCCAAACAUAU.........................
AL591978.1/56481-56658               ......GGACGAAAACCAAACAUAU.........................
AL591978.1/19809-19999               ......GGACAAGAAUCGAGAUA...........................
AL596167.1/167425-167616             ......GACAAGAAUUGAAAAUA...........................
AE015939.1/117645-117826             ......AAGUUUUCUUCUAUUAU...........................
AE007648.1/1506-1693                 ......GAGUUUAAGUACAAUAU...........................
AE015938.1/141777-141949             ......GGACGAAUCUUUCACAA...........................
AE015940.1/273052-272875             ......GGAGUUUUUUCAAAGUAA..........................
AE015941.1/2960-3143                 ......GAGUAUAUCAUUAUAU............................
AE015940.1/279870-279682             ......AGAGUAGUGCAGAAUAU...........................
AE007744.1/3364-3542                 .......UUACAAAACCAAUG.............................
AE015938.1/166402-166584             ......UGACGAAAUCUUAUAAAA..........................
AE015938.1/219824-220006             ......UGAGUUUAUUCCAUAA............................
AE015938.1/165030-165211             ......GAGUUAGGUUUUA...............................
AE015938.1/189808-189620             ......UGACAAGCCUUUAGUA............................
AE015944.1/6900-6723                 ......UGGACGAUUCCUAUUA............................
AE015938.1/189936-190117             ......UAAGUUUAUUCCAUAA............................
AE013010.1/3537-3777                 ......GGACGAAGCCCUAGUAA...........................
AE013011.1/30-270                    ......GGACGAAGCCCUAGUAA...........................
AE016952.1/63114-62943               ......GAUGAAACCAAUAAGA............................
BX294140.1/211185-211419             ......UGAAGUCUCAUUGUUUGCUUUUCUAUUCA...............
BX294144.1/76053-76292               ......AAGCAAACAUUCCUCUUGU.........................
AE005721.1/1901-2129                 ......GAGCCGCUGUCCGUUUCGU.........................
AE005849.1/870-1059                  ......GAGCUUCGCGUCACAU............................
AF306632.1/382-181                   ......GAGCCGCUGUCCAACGAU..........................
BX572599.1/256535-256331             ......UGAGCCGACGCAAUAC............................
BX572595.1/86162-86360               ......CGAGCCAUUGCCGAG.............................
BX572608.1/190529-190732             ......UCGUCUUUCGUCGGAU............................
BX572599.1/247113-247314             ......AUCGGAGCGUCCUCGCAU..........................
BX572596.1/50556-50756               ......UCUGUCCGGAUCAUGUA...........................
BX572595.1/100553-100338             ......GAGCGAUCCUUCAAUCG...........................
BX572600.1/273933-274129             ......GAGCCGACGUUCAGCAAA..........................
BX572599.1/259196-259407             ......UCGUCUCCGGUCACUCC...........................
BX572594.1/100625-100429             ......GAGCCAUUCGCCACAC............................
AE009726.1/9564-9351                 ......AGCUUUGCGCCCCAU.............................
AL672113.1/43141-43341               ......CGAGCCAAGCCCAUUGGU..........................
U45329.1/408-194                     ......CGAGCGAUGUCCAUCAU...........................
AE009122.1/6687-6504                 ......GAUGCUCUUUUUCUCAU...........................
AE008342.1/7843-8078                 ......UUGUUGUUCAUCCCAGUGACGCUUGAAGGCGUCAU.........
AE008981.1/4074-4298                 ......GAGCAUCGUUCCGAUUUGA.........................
AE008300.1/11923-11714               ......GAGCGAAAGUCCAUCAU...........................
AE009228.1/1838-1621                 ......UAAGCCCGCACCGUAAA...........................
AE009054.1/2448-2676                 ......AGAGCCUGAAACGAAAU...........................
AL591785.1/88210-88413               ......AACAGCCACGGCAGAAG...........................
AL591789.1/35311-34896               ......AUGGGCAGUCUCGUGAAGUUUGGCGGCAUGUCGGAAAA......
AL591788.1/218367-218154             ......GACGUUCUCGCCAAAAAGGGCUCUGAAUCUUUUCAGAGCUUU..
AF010496.1/116971-117194             ......GAGACGACGGUCGAAG............................
AF010496.1/105318-105541             ......AGAGGGCGCCCCGAG.............................
AF010496.1/39869-39652               ......CGAGCACCCCCCGGCA............................
AF193754.1/24966-24788               ........UUGAAACGCCAAAAA...........................
AF193754.1/4343-4142                 ......CGAGCAAAGAUCAAAAU...........................
AL646079.1/157144-156965             ......CGAGUCUGCGCCAACCA...........................
AL646070.1/4253-3997                 CGUCGCGCAGGUCCGUCCACAU............................
AE016915.1/175048-174863             ......AGAGUCCACGCCUGAC............................
AE016911.1/218236-218501             ......CCCAGGCGGCGCAGA.............................
BX321858.1/81804-81577               ......UCAAUGAUCUGCACAC............................
AE015548.1/1057-1279                 ......AGAAGCGCCUAGAUUCUAGAU.......................
AE015526.1/127-357                   ......AGAGACGGCCGCAUUC............................
M10112.1/56-247                      ......AGGUGCGAUGAUUGCGUUAUGCG.....................
AE016770.1/161998-162188             ......AGGUGCGAUGAUUGCGUUAUGCG.....................
AJ278144.1/22351-22163               ......AGGUGCGAUGAUUGCGUAAUGUG.....................
BX571869.1/30799-30632               ......UGACAACUCCGCUGAU............................
M57569.1/218-26                      ......AAGGUGAGAUGAGAGCGUAAGCA.....................
L12006.1/1016-1191                   ......UGACGACCCCGUAAAGA...........................
M89481.1/311-504                     ......AAGGUGAGAUGAGAGCGUAAGCA.....................
AL627279.1/139350-139157             ......AAGGUGAGAUGAGAGCGUAAGCA.....................
AE008893.1/4980-5173                 ......AAGGUGAGAUGAGAGCGUAAGCA.....................
AE016990.1/90583-90393               ......AGGUGCGAUGAUUGCGUUAUGCG.....................
AJ414159.1/142249-141989             ......AGUCACGGCGAUAGGUUUCUAACA....................
M34485.1/360-150                     ......GUAAACCAUAUUAAAAAAGUCAUUUAGACUUAC...........
AE004721.1/1492-1697                 ......AUCGCGCGCGAGCCCG............................
AE016783.1/50062-49864               ......CGAGCCUGCUCCAUCGAU..........................
AE004721.1/1433-1242                 ......CGAUCGUUCCCCAAU.............................
AE016783.1/53812-53604               .......GCGAACCCUUCGAGAU...........................
AE016787.1/55358-55152               ......CAACGGAUCGACACA.............................
AE016786.1/232051-232274             ........GUGAAGCGUCUGU.............................
AE004716.1/11608-11412               ......UGUAUUCGCGCCAUUC............................
AE004717.1/4221-4426                 .......GCGAAAUCCUCUUCAG...........................
AE016780.1/58096-58317               ......AAAAGGCCGCGCAGG.............................
AE016800.1/261827-262025             ......GAACGAAAGCUUAAUCA...........................
AE004105.1/5235-5438                 ......GAACGAACGCUCAAAC............................
AE012421.1/6485-6262                 ......GUCAGGUGCCGCAACAG...........................
AE011604.1/13614-13434               ......GACGAAAGACAUACUAA...........................
AE011315.1/3428-3605                 ......UGAGAUUUCGCAAUCAU...........................
AE017248.1/199120-198939             ......UAGUCUUUUUAAAAUAU...........................
AE017249.1/124649-124462             ......GAGUUGUUUUUCAAAAU...........................
AE017252.1/282498-282294             ......AGUUUGUUUAUCAUAAUGCAUCUAUGUAUUGGAAGCAUAA....
AK109157.1/8-245                     ......GGAGCGUGCUGCACGACAC.........................
U27616.3/1255-1032                   ......GAGUCAUCCUCCUAUGAUCGUAUCUUACGAUUAUA.........
#=GC SS_cons                         ............<<<<<<................................

BX248357.1/28572-28772               ....................GCCA..CUGAGAGUA.............UA
BX248356.1/172244-172444             ....................GCCA..CUGCA.................GU
Z94723.1/23034-23246                 .....................GCA..CUGGUCUUAG............AA
AL583923.1/215513-215333             ....................GCCA..CGGCC..................A
AE017236.1/265189-265430             .....................GCA..CUGGUC................GC
AE017236.1/188845-189025             ....................GCCA..CGGCU.................GA
BX842572.1/309867-309685             ....................GCCA..CGGCC..................A
BX248337.1/276050-275850             .....................GCA..CUGGUC................UC
BX248334.1/308192-308010             ....................GCCA..CGGCC..................A
AY033236.1/563-353                   ....................GGCA..CUGGGCG...............GC
AY033235.1/252-496                   ....................CCCA..CAUUGCCCCGGCGCAGGG....UC
AL939130.1/261334-261631             GGCGCCCAGCGUCCGGGCCCGCUG..CUUCGA................UC
AL939107.1/140625-140436             ....................GCCA..CUGCCCC...............GG
AL939107.1/133849-134073             .....................GCA..CUGGGCCCGAC...........GU
AL939110.1/156680-156867             ..........................CAGGAAC...............UC
AL939107.1/141879-142126             .....................GCA..CUGGGCCCCAG...........AU
AF263012.1/9229-9015                 .....................GCA..CUGGGCCC..............GG
AL939125.1/243385-243171             ....................GCCA..CUGGAUCGC.............UU
AL939123.1/7488-7321                 ..........................GUACGUCU..............UC
AJ295339.2/5-215                     ....................CGCACCCGGUCC................GU
AL939107.1/147400-147583             ....................GCCA..CUGCGC.................G
AY043208.1/560-782                   ....................GCCA..CUGGGAUACCUUUUUG......UA
AE016934.1/49817-49625               ....................GCCA..CUGGUG.................U
AE016932.1/26373-26579               ....................GCCA..CUGGAAA...............GC
AE016933.1/293262-293468             ....................GCCA..CUGAUG.................U
AE016934.1/101000-101187             ....................GUCA..CUGCAUC...............GG
AE016934.1/218065-217852             ....................GCCA..CUGGUG................AC
AE016932.1/22310-22515               ....................GCCA..CUGGAAA...............GA
AE017174.1/111334-111550             ....................GUCA..CUGUAGAAGGGCG.........UA
AE017174.1/95859-95679               ....................GCCA..CUGCAU................AU
AE017176.1/130222-129963             AUGAU...............GCCA..CUGUUCAUUC............UC
AE017174.1/143751-143548             ....................GCCA..CUAUAC................AG
AE017176.1/287850-287663             ....................UCCA..CUGUCCG...............UU
BX569694.1/273573-273792             ....................AACG..CCCGCCAGGAGC..........AC
AJ000758.1/1191-1370                 ....................ACCA..CUGUGAA...............AA
AJ000758.1/1489-1668                 ....................GCCA..CUG...................UA
AE017011.1/46644-46832               ....................GCCA..CUGU..................GA
AE017037.1/59439-59627               ....................ACCA..CUGU..................GA
AE017277.1/42695-42883               ....................GCCA..CUGU..................GA
AL596167.1/202425-202602             ....................GUCA..CUGGAA................GA
AL591978.1/56481-56658               ....................GUCA..CUGGAA................GC
AL591978.1/19809-19999               ....................ACCA..CUGUACGUU.............UU
AL596167.1/167425-167616             ....................ACCA..CUGUGCGUUU............UU
AE015939.1/117645-117826             ....................GCCA..CUGUU.................UU
AE007648.1/1506-1693                 ....................GUCA..CUGG..................GA
AE015938.1/141777-141949             ....................ACCA..CUCUUUC...............AA
AE015940.1/273052-272875             ....................ACCA..CUGGAUA...............AU
AE015941.1/2960-3143                 ....................GCCA..CUGUUGU...............UU
AE015940.1/279870-279682             ....................GCCA..CUGU..................UA
AE007744.1/3364-3542                 ....................UCCA..CUGGAG................UU
AE015938.1/166402-166584             ....................UCCA..CUAGAU................AU
AE015938.1/219824-220006             ....................GCCA..UUGAGA.................U
AE015938.1/165030-165211             .....................CCA..CUGUU.................AA
AE015938.1/189808-189620             ....................ACCA..CUCUU..................U
AE015944.1/6900-6723                 ....................UCCA..CCAG..................UU
AE015938.1/189936-190117             ....................GCCA..UUGAGA.................U
AE013010.1/3537-3777                 ....................GCCA..CUGUCCGGCAC...........UC
AE013011.1/30-270                    ....................GCCA..CUGUCCGGCAC...........UC
AE016952.1/63114-62943               .....................CCA..CAGA..................UU
BX294140.1/211185-211419             ....................GCCA..UUGCUCGUGUUUUCGCGUU...UC
BX294144.1/76053-76292               ....................GCCA..UUGUCGUUGAUCGGAA......UU
AE005721.1/1901-2129                 ....................GUCA..CUGACGCGC.............CG
AE005849.1/870-1059                  ....................GCCA..CUGGGCCC..............AA
AF306632.1/382-181                   ....................GUCA..CUGAAGCCU.............GC
BX572599.1/256535-256331             ....................GCCA..CUGGAU.................C
BX572595.1/86162-86360               ....................GCCA..CUGGG.................AA
BX572608.1/190529-190732             ....................GCCA..CUGGGAA...............CC
BX572599.1/247113-247314             ....................GCCA..CUGACC................AG
BX572596.1/50556-50756               ....................GCCA..CUGACGU...............CC
BX572595.1/100553-100338             ....................GCCA..CUGGGCA...............GC
BX572600.1/273933-274129             ....................GCCA..CUGGGA................GC
BX572599.1/259196-259407             ....................GCCA..CUGAGUUCGGCAUCC.......UA
BX572594.1/100625-100429             ....................GCCA..CUGGGC................UU
AE009726.1/9564-9351                 ....................GCCA..CUGGC.................GA
AL672113.1/43141-43341               ....................GUCA..CUGAGGC...............GA
U45329.1/408-194                     ....................GCCA..UUGGCC................CC
AE009122.1/6687-6504                 ....................GCCA..CUGAA.................GC
AE008342.1/7843-8078                 ....................GCCA..CUGUUUU...............UU
AE008981.1/4074-4298                 ....................GCCA..CUGGAGCC..............AA
AE008300.1/11923-11714               ....................GUCA..CUGAGG................CC
AE009228.1/1838-1621                 ....................GCCA..CUGAACCU..............UU
AE009054.1/2448-2676                 ....................GCCA..CUGGCAAGCCAUCUCGCCUCCAUC
AL591785.1/88210-88413               ....................GCCA..CUGGACA...............CC
AL591789.1/35311-34896               ....................GCCA..CUGGCGUG..............GC
AL591788.1/218367-218154             ....................GCCA..CUGAAUAU..............UG
AF010496.1/116971-117194             ....................ACCA..CUGGCCCCCCCGA.........UC
AF010496.1/105318-105541             ....................GCCA..CUGGC.................AC
AF010496.1/39869-39652               ....................ACCA..CUGGCCC...............CG
AF193754.1/24966-24788               ....................GCCA..CUGAA.................UC
AF193754.1/4343-4142                 ....................GCCA..CUGAUA................UU
AL646079.1/157144-156965             ....................GCCA..CCGCA..................C
AL646070.1/4253-3997                 ....................GCCA..CUGUUC................CG
AE016915.1/175048-174863             ....................GCCA..CUGGCCC...............UU
AE016911.1/218236-218501             ....................GCCA..CUGUUUUGGGCGCGUGU.....UC
BX321858.1/81804-81577               ....................GCCA..CUGUGCU...............GU
AE015548.1/1057-1279                 ....................UCUA..GAUUCUAGAU............UC
AE015526.1/127-357                   ....................GAUA..GGUGUUC...............AC
M10112.1/56-247                      ....................GACA..CUCGCC................AU
AE016770.1/161998-162188             ....................GACA..CUGCC.................AU
AJ278144.1/22351-22163               ....................GACA..CGGUC.................AU
BX571869.1/30799-30632               ....................GCCA..CUGGUCG...............GA
M57569.1/218-26                      ....................GACAC.CUGU...................C
L12006.1/1016-1191                   .....................CCA..CUGAUC................GC
M89481.1/311-504                     ....................GAAA..CUGCC..................U
AL627279.1/139350-139157             ....................GACA..CUGCC..................U
AE008893.1/4980-5173                 ....................GACA..CUGCC..................U
AE016990.1/90583-90393               ....................GACA..CUGCC.................AU
AJ414159.1/142249-141989             ....................GACA..CUGUCC................GC
M34485.1/360-150                     ....................GCCA..CUGCAUG...............CA
AE004721.1/1492-1697                 ....................GAGA..CCGGCCUG..............GA
AE016783.1/50062-49864               ....................GCCA..CUGGGC................CU
AE004721.1/1433-1242                 ....................GCCA..CUGCG..................U
AE016783.1/53812-53604               ....................ACCA..CUGUGC................UC
AE016787.1/55358-55152               ....................GCCA..CUGCGC................CA
AE016786.1/232051-232274             ....................ACCA..CUGUGCCUCGUA..........GU
AE004716.1/11608-11412               ....................GCCA..CUGG..................AU
AE004717.1/4221-4426                 ....................GCCA..CUGUGC................UC
AE016780.1/58096-58317               ....................GCCA..CUGGAUG...............CC
AE016800.1/261827-262025             ....................GACA..CUGCACGAU.............GG
AE004105.1/5235-5438                 ....................GACA..CUGCUU.................U
AE012421.1/6485-6262                 ....................GCCA..CUGUGC................AC
AE011604.1/13614-13434               ....................GCCA..CUGGG.................AC
AE011315.1/3428-3605                 ....................GCCA..CUGCGU................UA
AE017248.1/199120-198939             ....................GUCA..CUCGG.................GA
AE017249.1/124649-124462             ....................GCCA..CUGGU.................UU
AE017252.1/282498-282294             ....................GCCA..CUGU..................UA
AK109157.1/8-245                     ....................GCCA..CUGUGCCCC.............UC
U27616.3/1255-1032                   ....................GCCA..CUGAGCAU..............UC
#=GC SS_cons                         ....................<<<...<<<<<<..................

BX248357.1/28572-28772               AA................................................
BX248356.1/172244-172444             CC................................................
Z94723.1/23034-23246                 AA................................................
AL583923.1/215513-215333             UU................................................
AE017236.1/265189-265430             AA................................................
AE017236.1/188845-189025             CA................................................
BX842572.1/309867-309685             CA................................................
BX248337.1/276050-275850             AA................................................
BX248334.1/308192-308010             CA................................................
AY033236.1/563-353                   AA................................................
AY033235.1/252-496                   AG..........................................CCCCAC
AL939130.1/261334-261631             AC................................................
AL939107.1/140625-140436             UA................................................
AL939107.1/133849-134073             AC................................................
AL939110.1/156680-156867             UC................................................
AL939107.1/141879-142126             GA................................................
AF263012.1/9229-9015                 AC................................................
AL939125.1/243385-243171             GC................................................
AL939123.1/7488-7321                 GC................................................
AJ295339.2/5-215                     CC................................................
AL939107.1/147400-147583             CC................................................
AY043208.1/560-782                   AA................................................
AE016934.1/49817-49625               AA................................................
AE016932.1/26373-26579               AA................................................
AE016933.1/293262-293468             UA................................................
AE016934.1/101000-101187             CA................................................
AE016934.1/218065-217852             AU................................................
AE016932.1/22310-22515               AA................................................
AE017174.1/111334-111550             GU................................................
AE017174.1/95859-95679               CG................................................
AE017176.1/130222-129963             CA..............................................CU
AE017174.1/143751-143548             AA................................................
AE017176.1/287850-287663             CU................................................
BX569694.1/273573-273792             UA................................................
AJ000758.1/1191-1370                 AA................................................
AJ000758.1/1489-1668                 UU................................................
AE017011.1/46644-46832               AA................................................
AE017037.1/59439-59627               AA................................................
AE017277.1/42695-42883               AA................................................
AL596167.1/202425-202602             AA................................................
AL591978.1/56481-56658               AA................................................
AL591978.1/19809-19999               UA................................................
AL596167.1/167425-167616             GA................................................
AE015939.1/117645-117826             UU................................................
AE007648.1/1506-1693                 AA................................................
AE015938.1/141777-141949             AA................................................
AE015940.1/273052-272875             AU................................................
AE015941.1/2960-3143                 AU................................................
AE015940.1/279870-279682             AU................................................
AE007744.1/3364-3542                 UU................................................
AE015938.1/166402-166584             AU................................................
AE015938.1/219824-220006             AU................................................
AE015938.1/165030-165211             UU................................................
AE015938.1/189808-189620             AA................................................
AE015944.1/6900-6723                 AA................................................
AE015938.1/189936-190117             AU................................................
AE013010.1/3537-3777                 AA........CUGAGCGCGUUAGUAAGGAGAAAAGAGGGAGAGAAAUUGC
AE013011.1/30-270                    AA........CUGAGCGCGUUAGUAAGGAGAAAAGAGGGAGAGAAAUUGC
AE016952.1/63114-62943               AU................................................
BX294140.1/211185-211419             AA................................................
BX294144.1/76053-76292               AU................................................
AE005721.1/1901-2129                 AA................................................
AE005849.1/870-1059                  AA................................................
AF306632.1/382-181                   AC................................................
BX572599.1/256535-256331             AU................................................
BX572595.1/86162-86360               UU................................................
BX572608.1/190529-190732             UC................................................
BX572599.1/247113-247314             AU................................................
BX572596.1/50556-50756               UC................................................
BX572595.1/100553-100338             AC................................................
BX572600.1/273933-274129             GA................................................
BX572599.1/259196-259407             GA................................................
BX572594.1/100625-100429             UC................................................
AE009726.1/9564-9351                 AA................................................
AL672113.1/43141-43341               AC................................................
U45329.1/408-194                     AC................................................
AE009122.1/6687-6504                 AA................................................
AE008342.1/7843-8078                 UC................................................
AE008981.1/4074-4298                 AA................................................
AE008300.1/11923-11714               GG................................................
AE009228.1/1838-1621                 AU................................................
AE009054.1/2448-2676                 AA................................................
AL591785.1/88210-88413               GC................................................
AL591789.1/35311-34896               AUUGCGAUCAGCCGGGCAGGACGCCUCUUCUUCUACGAAUCGUCCGCCUU
AL591788.1/218367-218154             AA................................................
AF010496.1/116971-117194             CA................................................
AF010496.1/105318-105541             CA................................................
AF010496.1/39869-39652               AC................................................
AF193754.1/24966-24788               UA................................................
AF193754.1/4343-4142                 AU................................................
AL646079.1/157144-156965             GA................................................
AL646070.1/4253-3997                 CG................................................
AE016915.1/175048-174863             AG................................................
AE016911.1/218236-218501             AC.................GAUCUUUCGCCUGGCGUUGCCGGAAAAGACG
BX321858.1/81804-81577               AU................................................
AE015548.1/1057-1279                 UA................................................
AE015526.1/127-357                   GA................................................
M10112.1/56-247                      UC................................................
AE016770.1/161998-162188             CC................................................
AJ278144.1/22351-22163               CC................................................
BX571869.1/30799-30632               AA................................................
M57569.1/218-26                      CG................................................
L12006.1/1016-1191                   AA................................................
M89481.1/311-504                     CC................................................
AL627279.1/139350-139157             CC................................................
AE008893.1/4980-5173                 CC................................................
AE016990.1/90583-90393               CC................................................
AJ414159.1/142249-141989             AA................................................
M34485.1/360-150                     UA................................................
AE004721.1/1492-1697                 AC................................................
AE016783.1/50062-49864               GC................................................
AE004721.1/1433-1242                 GA................................................
AE016783.1/53812-53604               AA................................................
AE016787.1/55358-55152               AC................................................
AE016786.1/232051-232274             AC................................................
AE004716.1/11608-11412               UA................................................
AE004717.1/4221-4426                 CG................................................
AE016780.1/58096-58317               AG................................................
AE016800.1/261827-262025             AA................................................
AE004105.1/5235-5438                 UC................................................
AE012421.1/6485-6262                 AC................................................
AE011604.1/13614-13434               AA................................................
AE011315.1/3428-3605                 AA................................................
AE017248.1/199120-198939             AA................................................
AE017249.1/124649-124462             AU................................................
AE017252.1/282498-282294             AU................................................
AK109157.1/8-245                     UC................................................
U27616.3/1255-1032                   GU................................................
#=GC SS_cons                         ..................................................

BX248357.1/28572-28772               ............AACUCU.UG.G.GA...AGGU..GAGGCAAUUACUCUC
BX248356.1/172244-172444             ................UG.CG.G.GA...AGGG.UAGAAAGACACACUUU
Z94723.1/23034-23246                 .........AUCCGAGAC.UG.G.GA...AGC...GAUGGCCAUUAGAAG
AL583923.1/215513-215333             ................GG.CU.G.GA...AGGC..GAGGCAAGCGGUGAU
AE017236.1/265189-265430             ...............GAC.UG.G.GA...AGC...GACGGCCACUAGGAA
AE017236.1/188845-189025             ................AG.CU.G.GA...AGGC..GAGGCGAGCGGCGAU
BX842572.1/309867-309685             ................GG.CU.G.GA...AGGC..GAGGCAAGCAACGAU
BX248337.1/276050-275850             ..............CGAC.UG.G.GA...AGC...GACGGCCAGUAGGAG
BX248334.1/308192-308010             ................GG.CU.G.GA...AGGC..GAGGCAAGCAACGAU
AY033236.1/563-353                   ..............CGCC.UG.G.GA...AGUA..GUAGUGGAGGAAGUC
AY033235.1/252-496                   GAGCUGCCUGCGCGUGCA.CC.GCGA...AGGA..CGGCCCGUGGAUUUG
AL939130.1/261334-261631             ..GCAGGCGCACGGCCCG.AG.GCGA...AAGC..GAAACGCCUGUGGCC
AL939107.1/140625-140436             ..............GGGG.CG.G.GA...AGGC..CGGGACGAGCUGUGA
AL939107.1/133849-134073             ............CGGGCC.CG.G.GA...AGC...GACGGCCAGUAGGUG
AL939110.1/156680-156867             ......GCCGCCGUGCUC.UU.C.GA...A.....CCAGGGCGCGGACA.
AL939107.1/141879-142126             .........GUUGGAGCC.CG.G.GA...AGC...GACGGCCGGUAGGUG
AF263012.1/9229-9015                 .............GGGUC.UG.G.GA...AGC...GACGGCCACUAGGUG
AL939125.1/243385-243171             ..............GGUC.CG.G.GA...AGGC..GGAGCACGGGCGGUG
AL939123.1/7488-7321                 ...............ACG.UG.C.G.........CGCACGCCU.......
AJ295339.2/5-215                     ...............GUU.CC.G.G.....GUG..CCACAGACGUCCGGG
AL939107.1/147400-147583             ...............GCG.CG.G.GA...AGGC.CAGGGAGGAGCGUCGA
AY043208.1/560-782                   ...UAGAUAAGGAGUCAC.CG.G.GA...AGGC..GUCGGAAACAAG...
AE016934.1/49817-49625               ...............UAC.CG.G.GA...AGGC.ACGAUGACCG......
AE016932.1/26373-26579               ..............AUUC.CG.G.GA...AGGC..GUUCGCAACAG....
AE016933.1/293262-293468             ...............UUU.CG.G.GA...AGGC..ACUAUAAGACAA...
AE016934.1/101000-101187             ..............GAUG.UG.G.GA...AGGC..GCUGCGGGGGAG...
AE016934.1/218065-217852             ...............CAC.UG.G.GA...AGGC..GUGAUAAAUGG....
AE016932.1/22310-22515               ..............AUUC.CG.G.GA...AGGC..GCCCGCAACAG....
AE017174.1/111334-111550             ............CCCCUA.UG.G.GA...AGGC.CGACGAAGACCCGAUA
AE017174.1/95859-95679               ...............AUG.UG.G.GA...AGGC..GUAGCGAUUUA....
AE017176.1/130222-129963             AUUAGAGGUGGAGCUGAA.UG.G.GA...AGGC.GCGACAAACAGAAAAG
AE017174.1/143751-143548             .............UCGUA.UG.G.GA...AGGC..AGCGAAGCCUU....
AE017176.1/287850-287663             ...........GUGCGGA.UG.G.GA...AGGA..GUCGGAAGUAUG...
BX569694.1/273573-273792             .............CCGAC.GA.G.GAUCGACUU..UGACCAAUCUUCUGG
AJ000758.1/1191-1370                 ...............UCA.CG.G.GA...AGGU..UCUCAAGUAGAAUGA
AJ000758.1/1489-1668                 ...................CG.G.GA...AGGC..GCAAUCAAGUGAUGA
AE017011.1/46644-46832               .................A.CG.G.GA...AGGU.AAAAGAAAUUAUAUGA
AE017037.1/59439-59627               .................A.CG.G.GA...AGGU.AAAAGAAAUUAUAUGA
AE017277.1/42695-42883               .................A.CG.G.GA...AGGC.GAAAGAAAUCAUAUGA
AL596167.1/202425-202602             ...............UUC.CG.G.GA...AGAC..UGGUGAGUAGGUUGA
AL591978.1/56481-56658               ...............UUC.CG.G.GA...AGAC..UGGUGAGUAGGAUGA
AL591978.1/19809-19999               .............GCGUA.UG.G.GA...AGGU.UCGAUUGUUGGAUGAA
AL596167.1/167425-167616             ..............CGUA.UG.G.GA...AGGU..UCAAUUGUUGAAUGA
AE015939.1/117645-117826             ................AA.UG.G.GA...AGGC..AGAAGAAAAUUAUGA
AE007648.1/1506-1693                 .................C.UG.G.GA...AGGC..GUACUUAAGCAAUGA
AE015938.1/141777-141949             ............AGGGAA.GG.G.GA...AGGG..AAAGACAAGGGUGAA
AE015940.1/273052-272875             ...............AUC.UG.G.GA...AGGU.AUGAAAAAAUAAUGAA
AE015941.1/2960-3143                 ...............CAA.UG.G.GA...AGGC..AAUGAUGUACUAUGA
AE015940.1/279870-279682             .................A.UG.G.GA...AGGC.UUUGUACUAUGUUGAU
AE007744.1/3364-3542                 ...............CUC.UG.G.GA...AGGA..UGGUUGAGGCUAAA.
AE015938.1/166402-166584             ............UUUAUC.UG.G.GA...AGGU..UAGAAAUUAGGAAGA
AE015938.1/219824-220006             ...............UCU.UG.A.GA...AGGC..GGAAAUAAAUGAUGA
AE015938.1/165030-165211             ................AA.CG.G.GA...AGG...AGAAUCUAUAAAAAC
AE015938.1/189808-189620             ................AA.GGAG.GA...AGGU..AAAGGUUAGAAUGAU
AE015944.1/6900-6723                 .................C.UG.G.GA...AGGA..AGGAUAAGGAAGAAA
AE015938.1/189936-190117             ...............UCU.CG.A.GA...AGGU..GGAAAUAAAUGAUGA
AE013010.1/3537-3777                 GUUCAGUUGAGUGCCGGG.UG.G.GA...AGGC..AGGGUGGAGGAUGAG
AE013011.1/30-270                    GUUCAGUUGAGUGCCGGA.UG.G.GA...AGGC..AGGGUGGAGGAUGAG
AE016952.1/63114-62943               .................U.CU.G.GA...AGG...AUUGGGAGUAAGAAG
BX294140.1/211185-211419             ......CGUGAACGUGAG.UG.A.GA...AGGC..CAUGAGCAAACAAAG
BX294144.1/76053-76292               ........CCGUGACGGA.CG.A.GA...AGGC..GAGCGUUUGCGAGUU
AE005721.1/1901-2129                 GCUGGUUCGGGGAUGCGU.CG.G.GA...AGGCCAGGGCAGGGGUGACGA
AE005849.1/870-1059                  ..............GGCC.UG.G.GA...AGGC..GACGCCCAGAAGCAU
AF306632.1/382-181                   .............GGCUU.CG.G.GA...AGGC.CGGACAGCAGCGAUGA
BX572599.1/256535-256331             ...............AUC.CG.G.GA...AGGC..CGCGUCGGCGACGAC
BX572595.1/86162-86360               ................CC.UG.G.GA...AGGC..GGCGAAUGGCGGCGA
BX572608.1/190529-190732             .............GGUCC.UG.G.GA...AGGC..GACGGAAGAUCAA..
BX572599.1/247113-247314             ..............CGGU.CG.G.GA...AGGC..GGACGCGCCGGAUAU
BX572596.1/50556-50756               .............GGCGU.CG.G.GA...AGGC..GGUCCAGGCGAUAU.
BX572595.1/100553-100338             .............UUGCC.CG.G.GA...AGGC..GAAGGAUUGCGACGA
BX572600.1/273933-274129             ...............UCC.CG.G.GA...AGGU.CGAACAAAGGCGAUGA
BX572599.1/259196-259407             ............GCCGCU.CG.G.GA...AGGC..GACCGGGACAAUGU.
BX572594.1/100625-100429             ..............GUCC.UG.G.GA...AGGC..GGUGAACGGCAACGA
AE009726.1/9564-9351                 ................GC.CG.G.GA...AGGC..GGGUGGAAGCGUUGA
AL672113.1/43141-43341               .............GGCCU.CG.G.GA...AGAC..GGGCAGAGGCUUUGA
U45329.1/408-194                     ...............GGC.CG.A.UA...AGGC..GGACAAAGCCCAGAC
AE009122.1/6687-6504                 ................UU.CG.G.GA...AGGC..GAAAGGGGCGGAUGA
AE008342.1/7843-8078                 ............GGAAUG.CG.G.GA...AGGC.AGAUGAGGGACGCAAA
AE008981.1/4074-4298                 ..............GCUC.CG.G.GA...AGGC.UGGAAUAGAUGUUGUG
AE008300.1/11923-11714               ...............CCU.CG.G.GA...AGAC..GGACCAAAGCUAUGA
AE009228.1/1838-1621                 ..........GAUCGGUU.CG.G.GA...AGGC..GGUGACAGGGUGUUG
AE009054.1/2448-2676                 ...GGGGGAAGGCAAUGC.CG.G.GA...AGGU..GUUUCAGGUUUUGAC
AL591785.1/88210-88413               ...............GUC.CG.G.GA...AGGC..GCCGGGCAGGUCCCU
AL591789.1/35311-34896               UCGCGAUGCCGCAAACGC.CG.G.GA...AGGC..GAGGCGAGCCCGUUC
AL591788.1/218367-218154             ............GCUAUU.CG.G.GA...AGGC..GGCGCGAACGGAUGA
AF010496.1/116971-117194             ....CCGGGGAGAACGGC.CG.G.GA...AGGU..GACCCGAGUUGAUCG
AF010496.1/105318-105541             ................GC.CG.G.GA...AGGC..GGGGCGACCGUGAGG
AF010496.1/39869-39652               ..........CGCGGGGC.CG.G.GA...AGGU..GGGGAAGCCACGAC.
AF193754.1/24966-24788               ................UU.CG.G.GA...AGGC..GGUUGUUUCGAUG..
AF193754.1/4343-4142                 ...............UAU.CG.G.GA...AGGC.UGAUCGGACGCGGUGA
AL646079.1/157144-156965             ................UGCCG.G.GA...AGGC..GGCGCCAGGCGAUGA
AL646070.1/4253-3997                 ...............GAA.CG.G.GA...AGGC..GGCCGGACCCGGU..
AE016915.1/175048-174863             ............CAAGGU.CG.G.GA...AGGC..GGCGCCCGGACGGCG
AE016911.1/218236-218501             GAGAGCAGGCUUCCAGAA.UG.G.GA...AGGC..GCGCCGCCGGCAA..
BX321858.1/81804-81577               ..............GGCA.CG.G.GA...AGGC..GCAGAAUCAGGAAAA
AE015548.1/1057-1279                 .........GAUUCUAGA.UU.C.UA...AAGC..CUAGCACCUUCUUUU
AE015526.1/127-357                   .............UGAAC.CC.G.UA...AAUC..GCAGUGUGCAAAGGU
M10112.1/56-247                      ...............GGU..G.G.GA...AGUC..AUCAUCUCUUAGUAU
AE016770.1/161998-162188             ................GG.UG.G.GA...AGUC..AUCAUCUCUUAGUAU
AJ278144.1/22351-22163               ................GG.UG.G.GU...GGUC..AUCUCUUUGUAUCUU
BX571869.1/30799-30632               ...............GAC.UG.G.GA...AGGU.UGCGGGGAAGGGUGAC
M57569.1/218-26                      .................G.CG.G.GA...AGUC.AUCAUUUCUGCUAUCC
L12006.1/1016-1191                   ...............GAU.UG.G.GA...AGG...ACGGGCGAGGAGGAC
M89481.1/311-504                     ................GG.CG.G.GA...AGUC.AUCAUUUCUGCUAUCC
AL627279.1/139350-139157             ................GG.CG.G.GA...AGUC.AUCAUUUCUGCUAUCC
AE008893.1/4980-5173                 ................GG.CG.G.GA...AGUC.AUCAUUUCUGCUAUCC
AE016990.1/90583-90393               ................GG.UG.G.GA...AGUC..AUCAUCUCUUAGUAU
AJ414159.1/142249-141989             ...............GGA.UG.G.GA...AGUC..AUCGCCUGCUCUAUU
M34485.1/360-150                     ..............GAUG.UG.G.GA...AGGU.GAAUAUGCUUGUCUCU
AE004721.1/1492-1697                 ...........CUUUCGU.UU.G......AUUC.ACCCGCGGUGGGCGG.
AE016783.1/50062-49864               ..............CGCC.CG.G.GA...AGGC.CGGAGCCGGGCCGUGA
AE004721.1/1433-1242                 ................CG.CG.G.GA...AGGC..GGGGAACCGGCGGAG
AE016783.1/53812-53604               ...............GCA.UG.G.GA...AGGU..GAAGGUUUCAUGCCC
AE016787.1/55358-55152               ...............GCG.CG.G.GA...AGGC..GUCAUCCCGCCAGCC
AE016786.1/232051-232274             ..............GGCA.UG.G.GA...AGGU..GACGCGUUCCAGGAG
AE004716.1/11608-11412               .................C.CG.G.GA...AGGC..GGCGCGAAGCGGAGG
AE004717.1/4221-4426                 ...............GCA.UG.G.GA...AGGC..GAGGAUUUCACGACC
AE016780.1/58096-58317               ..............CAUC.CG.G.GA...AGGC..GCGCAGGCCAGGGCC
AE016800.1/261827-262025             .............UCGUG.UG.G.GA...AGUC..AGGCAAGUAGGUUAA
AE004105.1/5235-5438                 ...............GAG.UG.G.GA...AGUC..GAGCCAGUAGGCCAA
AE012421.1/6485-6262                 ...............GCA.UG.G.GA...AGGC..GCGGUACCGGAAGCG
AE011604.1/13614-13434               ................CC.UG.G.GA...AGGC..GUGUCGAGUAGAAAG
AE011315.1/3428-3605                 ..............UACG.CG.G.GA...AGGC..UGCGAAAUCG.....
AE017248.1/199120-198939             ................UC.GG.G.GA...AGGC..UUAAAAAGAUGAUGA
AE017249.1/124649-124462             ................UC.CG.G.GA...AGGC..GAAAAUCAAUGAUGA
AE017252.1/282498-282294             .................A.UG.G.GA...AGGC..GAUAAACUUUAAAU.
AK109157.1/8-245                     .............GGGCA.UG.G.GA...AGGC..GCGGCAGGCUUGCCA
U27616.3/1255-1032                   ...............GUU.CG.G.GA...AGGC..GGAGGACCGAUGAAG
#=GC SS_cons                         ...............>>>.>>.>.......>>>..>>>>>>.........

BX248357.1/28572-28772               G.................................................
BX248356.1/172244-172444             U.................................................
Z94723.1/23034-23246                 C.................................................
AL583923.1/215513-215333             ..................................................
AE017236.1/265189-265430             C.UGCCCGGCUCCUCGGCGGCCCUUCGGGACCGCAUCGUCGGCCGGGCAC
AE017236.1/188845-189025             ..................................................
BX842572.1/309867-309685             ..................................................
BX248337.1/276050-275850             C.................................................
BX248334.1/308192-308010             ..................................................
AY033236.1/563-353                   G.................................................
AY033235.1/252-496                   A.................................................
AL939130.1/261334-261631             A.................................................
AL939107.1/140625-140436             C.................................................
AL939107.1/133849-134073             U..............................................CCU
AL939110.1/156680-156867             ..................................................
AL939107.1/141879-142126             C...................................CCGCCGGUGAUCCG
AF263012.1/9229-9015                 U.................................................
AL939125.1/243385-243171             G.................................................
AL939123.1/7488-7321                 ..................................................
AJ295339.2/5-215                     C.................................................
AL939107.1/147400-147583             U.................................................
AY043208.1/560-782                   ..................................................
AE016934.1/49817-49625               ..................................................
AE016932.1/26373-26579               ..................................................
AE016933.1/293262-293468             ..................................................
AE016934.1/101000-101187             ..................................................
AE016934.1/218065-217852             ..................................................
AE016932.1/22310-22515               ..................................................
AE017174.1/111334-111550             A.................................................
AE017174.1/95859-95679               ..................................................
AE017176.1/130222-129963             A.................................................
AE017174.1/143751-143548             ..................................................
AE017176.1/287850-287663             ..................................................
BX569694.1/273573-273792             C.................................................
AJ000758.1/1191-1370                 U.................................................
AJ000758.1/1489-1668                 A.................................................
AE017011.1/46644-46832               A.................................................
AE017037.1/59439-59627               A.................................................
AE017277.1/42695-42883               A.................................................
AL596167.1/202425-202602             U.................................................
AL591978.1/56481-56658               U.................................................
AL591978.1/19809-19999               ..................................................
AL596167.1/167425-167616             ..................................................
AE015939.1/117645-117826             U.................................................
AE007648.1/1506-1693                 U.................................................
AE015938.1/141777-141949             ..................................................
AE015940.1/273052-272875             ..................................................
AE015941.1/2960-3143                 ..................................................
AE015940.1/279870-279682             U.................................................
AE007744.1/3364-3542                 ..................................................
AE015938.1/166402-166584             A.................................................
AE015938.1/219824-220006             A.................................................
AE015938.1/165030-165211             U.................................................
AE015938.1/189808-189620             ..................................................
AE015944.1/6900-6723                 ..................................................
AE015938.1/189936-190117             A.................................................
AE013010.1/3537-3777                 ..................................................
AE013011.1/30-270                    ..................................................
AE016952.1/63114-62943               A.................................................
BX294140.1/211185-211419             U.................................................
BX294144.1/76053-76292               U.................................................
AE005721.1/1901-2129                 C.................................................
AE005849.1/870-1059                  U.................................................
AF306632.1/382-181                   C.................................................
BX572599.1/256535-256331             ..................................................
BX572595.1/86162-86360               C.................................................
BX572608.1/190529-190732             ..................................................
BX572599.1/247113-247314             ..................................................
BX572596.1/50556-50756               ..................................................
BX572595.1/100553-100338             C.................................................
BX572600.1/273933-274129             C.................................................
BX572599.1/259196-259407             ..................................................
BX572594.1/100625-100429             C.................................................
AE009726.1/9564-9351                 G.................................................
AL672113.1/43141-43341               C.................................................
U45329.1/408-194                     ..................................................
AE009122.1/6687-6504                 ..................................................
AE008342.1/7843-8078                 U.................................................
AE008981.1/4074-4298                 A.................................................
AE008300.1/11923-11714               C.................................................
AE009228.1/1838-1621                 A.................................................
AE009054.1/2448-2676                 ..................................................
AL591785.1/88210-88413               U.................................................
AL591789.1/35311-34896               GGUCUUUUGCCGCAUCGUUUUUCGGGCCGAGCCGGUCCGGCGAACGUGCG
AL591788.1/218367-218154             ..................................................
AF010496.1/116971-117194             A.................................................
AF010496.1/105318-105541             G.................................................
AF010496.1/39869-39652               ..................................................
AF193754.1/24966-24788               ..................................................
AF193754.1/4343-4142                 C.................................................
AL646079.1/157144-156965             C.................................................
AL646070.1/4253-3997                 ..................................................
AE016915.1/175048-174863             A.................................................
AE016911.1/218236-218501             ..................................................
BX321858.1/81804-81577               C.................................................
AE015548.1/1057-1279                 ..................................................
AE015526.1/127-357                   C.................................AGUUUCGCGUUUAUCU
M10112.1/56-247                      C.................................................
AE016770.1/161998-162188             C.................................................
AJ278144.1/22351-22163               C.................................................
BX571869.1/30799-30632               ..................................................
M57569.1/218-26                      A.................................................
L12006.1/1016-1191                   ..................................................
M89481.1/311-504                     A.................................................
AL627279.1/139350-139157             A.................................................
AE008893.1/4980-5173                 A.................................................
AE016990.1/90583-90393               C.................................................
AJ414159.1/142249-141989             U.........CGCGCCAUUUAUUUAUCACAGUAUUUUUACUGUCAUAACC
M34485.1/360-150                     U.................................................
AE004721.1/1492-1697                 ..................................................
AE016783.1/50062-49864               C.................................................
AE004721.1/1433-1242                 A.................................................
AE016783.1/53812-53604               C.................................................
AE016787.1/55358-55152               C.................................................
AE016786.1/232051-232274             C.................................................
AE004716.1/11608-11412               U...........................................UCCUCC
AE004717.1/4221-4426                 C.................................................
AE016780.1/58096-58317               A.................................................
AE016800.1/261827-262025             C.................................................
AE004105.1/5235-5438                 C.................................................
AE012421.1/6485-6262                 C.................................................
AE011604.1/13614-13434               A.................................................
AE011315.1/3428-3605                 ..................................................
AE017248.1/199120-198939             A.................................................
AE017249.1/124649-124462             C.................................................
AE017252.1/282498-282294             ..................................................
AK109157.1/8-245                     C...........................................GGUGGA
U27616.3/1255-1032                   A.................................................
#=GC SS_cons                         ..................................................

BX248357.1/28572-28772               ...........CGUAGAGCACCCCAGUCCGAAGACCG...GCCUAAUCAG
BX248356.1/172244-172444             ..........UACUGGGCGCGG.UAGCCAGGAGACCG...GCUUCAACAU
Z94723.1/23034-23246                 .ACCUAUCCAGUGCGCGCCUGC.GAGUCCGAAGACCU...GCCGGCUGUG
AL583923.1/215513-215333             ..................CCGA.GAGCCAGGAAACUC...GCGUCAUCGC
AE017236.1/265189-265430             GCACCACCCGGUGCGCGCCUGC.GAGUCCGGAGACCU...GCCAGCUGUG
AE017236.1/188845-189025             ..................CCGA.GAGCCAGGACACUC....GCGUCAUCG
BX842572.1/309867-309685             ..................CCGG.GAGCCAGGAGACUC...GCGUCAUCGC
BX248337.1/276050-275850             .ACCCACCGGGUGCGAGCCUGC.GAGUCCGAAGACCU...GCCAGCCGUG
BX248334.1/308192-308010             ..................CCGG.GAGCCAGGAGACUC...GCGUCAUCGC
AY033236.1/563-353                   GGAGUGAUCUCGCAAUGCCCAU.GAGUCCGAAGACCU...GCCAGCAGCG
AY033235.1/252-496                   ...........GGUUCUUGUCC.GAGCCCGCAG.GCU...CACGAGGGCA
AL939130.1/261334-261631             ..............CGCUCCGC.GA..CCGGAUACCC...GCCGCCCCAC
AL939107.1/140625-140436             ..................CCGG.GAGCCAGGAAACUC...ACGUCGUCGC
AL939107.1/133849-134073             CCGGACAGGAGGGUGGGCCCGC.GAGUCCGAAGACCU...GCCACCUGCC
AL939110.1/156680-156867             ..................CCCU.GAGUGAG..GACCUAUCGCCAUGCGCG
AL939107.1/141879-142126             UGUCCCCGGUGAGCGCGCCCAC.GAGUCCGAAGACCU...GCCACUGCGC
AF263012.1/9229-9015                 .CUGCCCGGCAGACGUGCCCGC.GAGUCCGAAGACCU...GCCCGCUGCC
AL939125.1/243385-243171             ...............UACCCGU.AAGCCAGGAGACCG...GCCAAGGCGC
AL939123.1/7488-7321                 ....................GUCCAGUCCGAGGACCU...GCCGACAGUG
AJ295339.2/5-215                     ............CUCGCGGAGU.GGGCCGGUGGACGC...GGCGCGCCGC
AL939107.1/147400-147583             ..................CCGG.GAGUCAGGACACUG...GCCUGUCGCG
AY043208.1/560-782                   ..................GAGU.CAGUCAGAAGACCU...GCCGCUUAUC
AE016934.1/49817-49625               ..................GGAC.GAGUCAGAAGACCU...GCCAUGACCG
AE016932.1/26373-26579               ..................GAAC.AAGUCAGAAGACCU...ACCAUGCAAA
AE016933.1/293262-293468             ..................GAGU.CAGUCAGAAGACCU...GCCACUUCGC
AE016934.1/101000-101187             ..................GGAU.AAGUCAGAAGACCU...GCCGGAGUCA
AE016934.1/218065-217852             ..................GGAC.GAGUCAGAAGACCU...GCCUUGACGC
AE016932.1/22310-22515               ..................GAAU.AAGUCAGAAGACCU...GCCAUGUAAA
AE017174.1/111334-111550             .................GAAGCUAAGCCAGAAGACCU...GCUUUAGUAG
AE017174.1/95859-95679               ..................GGCC.GAGUCGGAAGACCU...GCCGCACAUA
AE017176.1/130222-129963             ..............GAUGAAGU.AAGCCAGAAUACCU...GCCUCUACGA
AE017174.1/143751-143548             ..................GAAU.AAGUCAGAAGACCU...GCCAUUACAA
AE017176.1/287850-287663             ..................GGGU.GAGCCAGAAGACCU...GCAAAGUCUU
BX569694.1/273573-273792             .......UUCUCCCCGGCCUCU.GCGCCAGG...CC....GCCGUUGCCG
AJ000758.1/1191-1370                 ..................ACAC.AAGUCAGGAGACCU...GUCUUUAUUG
AJ000758.1/1489-1668                 ...................UCG.AAGUCAGGAAACCA...GCCUUUUUCU
AE017011.1/46644-46832               ..................GCAU.AAGUCAGGAGACCU...GCCUGUUUUA
AE017037.1/59439-59627               ..................GCAU.AAGUCAGGAGACCU...GCCUGUUUUA
AE017277.1/42695-42883               ..................GCAU.AAGUCAGGAGACCU...GCCUGUUUUA
AL596167.1/202425-202602             ...................GAU.AAGUCAGGAGACC....GCUAGUAUAU
AL591978.1/56481-56658               ...................GUU.AAGUCAGGAGACC....GCUUUUAUAU
AL591978.1/19809-19999               ...................GCC.AAGUCAGGAUACUC...GCCAAAUAAG
AL596167.1/167425-167616             ..................AGCC.AAGUCAGGAUACUC...GCCAAAUAAG
AE015939.1/117645-117826             ..................ACUC.GAGCCAGAAUAUCU...GCCUAUUUUA
AE007648.1/1506-1693                 ..................UUUU.GAGCCAGGAUACUU...GCCAUAUUCU
AE015938.1/141777-141949             ..................UCAU.GAGCCAGGAGACCU...GCCUGUAUAU
AE015940.1/273052-272875             ...................CCU.AAGUCAGAAUACCU...ACCUAAAUUA
AE015941.1/2960-3143                 ..................UCUC.AAGUCAGGAGACCU...ACCAUAAAAA
AE015940.1/279870-279682             ...................UUU.AAGUCAGAAGACCU...GCCUGUUGUU
AE007744.1/3364-3542                 ..................CUGU.GAGCCAGGAGACCU...ACCUAAAAUA
AE015938.1/166402-166584             ...................GCU.AAGCCAGGAAACCU...GCCUAAUAAG
AE015938.1/219824-220006             ..................CCAU.AAGUCAGGAGACCU...GCUUUAUAAG
AE015938.1/165030-165211             .............AUGAACUGU.AAGUCAGGAGACCU...GCCUUUUUUU
AE015938.1/189808-189620             ..................UCUU.AAGCCAGGAGACCU...GCCUAGAUUG
AE015944.1/6900-6723                 ...................CUA.AAGUCAGGAGAACU...GCCUAAAAUA
AE015938.1/189936-190117             ..................CCAU.AAGUCAGGAGACCU...GCUUUAUAUU
AE013010.1/3537-3777                 ..................UCCC.GAGCCAGGAGACCU...GCCAUAAGGU
AE013011.1/30-270                    ..................UCCC.GAGCCAGGAGACCU...GCCAUAAGGU
AE016952.1/63114-62943               ..................AGCU.AAGUCAGGAUACCG...GCUUGAUAAG
BX294140.1/211185-211419             ................GGUGGU.GAGUCAGAAGACCU...ACCUCGUACA
BX294144.1/76053-76292               ...............GCAUCGG.GAGUCAGAAGACCU...ACCACGAAAC
AE005721.1/1901-2129                 ..................CCGU.GAGCCAGGAGACCU...GCCUCGACAG
AE005849.1/870-1059                  ...............GACCCGU.GAGCCAGGAGACCU...GCCCGGCGCA
AF306632.1/382-181                   ..................CAGC.AAGCCAGGAGACCG...GCCCCGACAA
BX572599.1/256535-256331             ..................CCGU.GAGCCAGGAGACCU...GCCGUCGCCU
BX572595.1/86162-86360               ..................UCGC.GAGCCAGGAGACCU...GCCAUCGCGU
BX572608.1/190529-190732             ..................CCGC.GAGCCAGGAGACCU...GCCGUCAUUC
BX572599.1/247113-247314             ..................CCGC.GAGCCAGGAGACCG...GCCGGUACAA
BX572596.1/50556-50756               ..................CCGU.GAGCCAGGAGACCG...GCCGAAGACG
BX572595.1/100553-100338             ..................CCGU.GAGCCAGGAGACCG...GCCUGAGUAC
BX572600.1/273933-274129             ..................CCGC.GAGCCAGGAGACCU...GCCUCGUCGA
BX572599.1/259196-259407             ..................CCGC.GAGCCAGGAGACCG...GCCGAAGUCC
BX572594.1/100625-100429             ..................CCGC.GAGCCAGGAGACCU...GCCGUCAGUC
AE009726.1/9564-9351                 ..................CCGU.GAGCCAGGAGACCU...GCCUUGAGCG
AL672113.1/43141-43341               ..................CCGC.GAGCCAGGAGACCU...GCCACGACGA
U45329.1/408-194                     ..................CCGU.GAGCCAGGAGACCU...GCCGAUAAGC
AE009122.1/6687-6504                 ..................AGCU.UAGUCAGAAGACCG...GCCUGGCAGG
AE008342.1/7843-8078                 ..................CCGU.GAGCCAGGAGACCU...GCCGUCAAAA
AE008981.1/4074-4298                 .................CCCGC.AAGUCAGGAGACCU...GCCUUGAGCG
AE008300.1/11923-11714               ..................CCGC.AAGCCAGGAGACCU...GCCGCGAUAG
AE009228.1/1838-1621                 ...............UAGCCGC.AAGCCAGGAGACCU...GCCGUUUCAG
AE009054.1/2448-2676                 ..................CCGU.AAGCCAGGAGACCU...GCCAUCACGG
AL591785.1/88210-88413               .........GCGGACGGCUCCA.GAGCCCGGAAACCA...GCCUUGAAGC
AL591789.1/35311-34896               GCCAUGAGGAUCGUGACGCCGU.GAGCCAGGAGACCU...GCCAUCCGUC
AL591788.1/218367-218154             ..................UCCG.AAGUCAGAAGACCG...GCCUGGCGAG
AF010496.1/116971-117194             .................ACCGC.AAGUCAGGAGACCU...GCCAUCGCUC
AF010496.1/105318-105541             ...GACCCCCCCUCGCAUCCGC.AAGCCGGGAGACCU...GCCAGCGCAU
AF010496.1/39869-39652               ..................CCGC.AAGUCAGGAGACCU...GCCAUCAGCG
AF193754.1/24966-24788               ..................CUGU.GAGCCAGGAGACCG...ACCCUAUGUA
AF193754.1/4343-4142                 ..................CCGUCAAGUCAGGAGACCU...GCCUUAAACC
AL646079.1/157144-156965             ..................GCGC.GAGCCAGGAGACCG...GCCAUCUCCU
AL646070.1/4253-3997                 ..................UCGC.CAGCCCGGAUACCG...GCCAGGACAG
AE016915.1/175048-174863             .................CGCGC.GAGCCAGGAGACCG...GCCGUCAAAC
AE016911.1/218236-218501             ..................GGCC.CAGCCCGGAGACCG...GCCUGCGUCG
BX321858.1/81804-81577               .......ACAGCUUCCGCUCAU.AAGUCCGGAGACCG...GCCUGAAGCA
AE015548.1/1057-1279                 ..................CUAC.AAGUCAGGAGACCU...GCCUAUUGCU
AE015526.1/127-357                   CUAGUGAGAUGGAUUAUAGCCU.AAGUCCGGAGACCG...GCCCUAAAGG
M10112.1/56-247                      ........UUAGAUACCCCUCC.AAGCCCGAAGACCU...GCCGGCCAAC
AE016770.1/161998-162188             ........UUAGAUACCCCUCC.AAGCCCGAAGACCU...GCCGGCCAAC
AJ278144.1/22351-22163               ..........AGAUGCCCUUCU.AGGUCUGAAGACCU...GUCGGUUAAC
BX571869.1/30799-30632               ...................GCU.AAGCCAGAAGACCG...ACCUGACAGG
M57569.1/218-26                      ...GCCAACGGAUAACCC.UCC.AAGCCCGAAGACCU...GCCGGCUAAC
L12006.1/1016-1191                   ...................GCU.AAGCCAGAAGACCU...GCCUGUCGGU
M89481.1/311-504                     ...GCCAACGGAUAACCC.UCC.AAGCCCGAAGACCU...GCCGGCUAAC
AL627279.1/139350-139157             ...GUCAACGGAUAACCC.UCC.AAGCCCGAAGACCU...GCCGGCUAAC
AE008893.1/4980-5173                 ...GCCAACGGAUAACCC.UCC.AAGCCCGAAGACCU...GCCGGCUAAC
AE016990.1/90583-90393               ........UUAGAUACCCCUCC.AAGCCCGAAGACCU...GCCGGCCAAC
AJ414159.1/142249-141989             AUGGCCUGAUACCAGAGAUCCU.AAGCCCGAAGACCU...GCCG.GUAUU
M34485.1/360-150                     .......UUUGAGAUGCCAUUU.GAGUCCGGAGACCU...GCUUGUUACA
AE004721.1/1492-1697                 ..................GCGC.AAGCGUGAAG.CGG...GCCGUCCGGG
AE016783.1/50062-49864               ..................GCAC.CAGUCAGGAGACCU...GCCGGCCUAC
AE004721.1/1433-1242                 ...........CGCCAGACCGU.GAGCCAGGAGACCU...GCCUCGUCGA
AE016783.1/53812-53604               ..................UCGC.AAGCCCGGAGACCG...GCCUGGAGCU
AE016787.1/55358-55152               GAACGGGGACAUGGAACGGUGC.AAGCCAGGAGACCU...GCCUCGUCAC
AE016786.1/232051-232274             .......CCAGCUCUUCCUCGC.AAGCCCGGAGACCG...GCCUGGCGUU
AE004716.1/11608-11412               CCCGGGUGGAACGCCGGGCUGC.GAGCCAGGAGACCU...GCCGCCGAAA
AE004717.1/4221-4426                 ..................UCGC.AAGCCCGGAGACCG...GCCUGCAACG
AE016780.1/58096-58317               ..........AGGCCCACUCAC.AAGCCCGGAGACCG...GCCUGAUACU
AE016800.1/261827-262025             ...............AGCUCUU.GAGUCCGAAUACCU...GCCAGCAACU
AE004105.1/5235-5438                 .............AGUGCUCUC.AAGUCCGAAGACCU...GCCAGCAACU
AE012421.1/6485-6262                 ........AGGCUUCCACUCGC.GAGCCCGGAGACCG...GCCUGAGGGA
AE011604.1/13614-13434               ..................UUUC.AAGUCAGAAUA.CG...ACCUAUGAAA
AE011315.1/3428-3605                 ..................GCGA.AAGCCAGAAGACCU...AACAAGUAAA
AE017248.1/199120-198939             ..................GCUCGAAGUCAGAAUACCU...GCCUGUAAAG
AE017249.1/124649-124462             ..................CUCC.GAGCCGUAAGACCU...GCCAAUGACU
AE017252.1/282498-282294             ...................CAU.AAGUCAGGAGACCU...GCCUAUUUGU
AK109157.1/8-245                     UUCGUCCGCCGCGGCCACUCGC.AAGCCCGGAUACCG...GCCUGACGCA
U27616.3/1255-1032                   .................CCCGG.AAGUCAGGAGACCU...GCCGUAUCCA
#=GC SS_cons                         ..................>>>>.....>>>....>>>...>>>>>>....

BX248357.1/28572-28772               AAACAUGUGCU
BX248356.1/172244-172444             UUUAUACGUAG
Z94723.1/23034-23246                 UCGGGCGCGCC
AL583923.1/215513-215333             GUCCUGCUAAC
AE017236.1/265189-265430             CCGGGCGCGCC
AE017236.1/188845-189025             CGUCCUGCGAC
BX842572.1/309867-309685             GUCCUGCCACC
BX248337.1/276050-275850             CCGGACGCGCC
BX248334.1/308192-308010             GUCCUGCCACC
AY033236.1/563-353                   ACAACAUCUGU
AY033235.1/252-496                   GCAGCGCCCUG
AL939130.1/261334-261631             CGGACCGUACC
AL939107.1/140625-140436             CUCCUCGACGG
AL939107.1/133849-134073             CGCGCGCGGAC
AL939110.1/156680-156867             GCUGCCGUUCC
AL939107.1/141879-142126             CCGUACGCGAU
AF263012.1/9229-9015                 CGCACGCGACC
AL939125.1/243385-243171             GUCGUCCAUCC
AL939123.1/7488-7321                 CGCCCGGCCGC
AJ295339.2/5-215                     GCGUAUCCCGG
AL939107.1/147400-147583             GGCCCGUUCCG
AY043208.1/560-782                   AAAGGCUGUUU
AE016934.1/49817-49625               GAAUGAGAUUU
AE016932.1/26373-26579               CUCGUUUCACU
AE016933.1/293262-293468             GUAAAGCGUUC
AE016934.1/101000-101187             AAUAAACAUAU
AE016934.1/218065-217852             UGCAGAUUUAU
AE016932.1/22310-22515               AUCCGUUUCAC
AE017174.1/111334-111550             AUUUGUUCUAA
AE017174.1/95859-95679               UCUAAAAGAUG
AE017176.1/130222-129963             GUUGCCUAUAA
AE017174.1/143751-143548             GCGUUCUUUCU
AE017176.1/287850-287663             UGUCUGCGGCU
BX569694.1/273573-273792             CAUUGGCCUUG
AJ000758.1/1191-1370                 UGAAGUUUCUA
AJ000758.1/1489-1668                 AAUGCUAAGCU
AE017011.1/46644-46832               ACAACACUGAU
AE017037.1/59439-59627               ACAACACUGAU
AE017277.1/42695-42883               ACAACACUGAU
AL596167.1/202425-202602             UCGAUAUCCAA
AL591978.1/56481-56658               UCGAUAUCCAA
AL591978.1/19809-19999               ACGGAAGCAAC
AL596167.1/167425-167616             ACGGAAGCAAC
AE015939.1/117645-117826             UUCACUAUAGC
AE007648.1/1506-1693                 AGUAUGUUUUU
AE015938.1/141777-141949             GAAAGAUAAAC
AE015940.1/273052-272875             AAUACACUAUA
AE015941.1/2960-3143                 CUUAUACAAUU
AE015940.1/279870-279682             AUAGAUCAUAC
AE007744.1/3364-3542                 UUAUGGAACUU
AE015938.1/166402-166584             UGUUAAUUCUU
AE015938.1/219824-220006             AAUAAAUAUAC
AE015938.1/165030-165211             AAUUAAACAUU
AE015938.1/189808-189620             UUAAAAUCCUC
AE015944.1/6900-6723                 UAUUACUUCGG
AE015938.1/189936-190117             UAAGAUGCAGC
AE013010.1/3537-3777                 UUUAGAAGUUC
AE013011.1/30-270                    UUUUAAAAGUU
AE016952.1/63114-62943               UCUAAUCAUUC
BX294140.1/211185-211419             AGACGUUUUGG
BX294144.1/76053-76292               GGACACUAUGU
AE005721.1/1901-2129                 AUAACGUCCUC
AE005849.1/870-1059                  GUCGUUCAUCG
AF306632.1/382-181                   UAUAUUGGUCC
BX572599.1/256535-256331             GCUAUGUUGAC
BX572595.1/86162-86360               AUUGUGCUUUG
BX572608.1/190529-190732             GUGGUCACACG
BX572599.1/247113-247314             GGUGUGCAACU
BX572596.1/50556-50756               GGAAGCAUCUA
BX572595.1/100553-100338             GUCAUCUUCCA
BX572600.1/273933-274129             ACGAAACGUCC
BX572599.1/259196-259407             GCAACCAAGCC
BX572594.1/100625-100429             GUGGUCACACG
AE009726.1/9564-9351                 UGAACGUCCAC
AL672113.1/43141-43341               ACAACGUCCAC
U45329.1/408-194                     AUGCGCGAAAG
AE009122.1/6687-6504                 AUAGACCGAAC
AE008342.1/7843-8078                 UGGAAACCAUC
AE008981.1/4074-4298                 CAAAUGUCCAC
AE008300.1/11923-11714               AUAACGUCCAC
AE009228.1/1838-1621                 GAAAAAGCGUC
AE009054.1/2448-2676                 AAAUAUCCAUG
AL591785.1/88210-88413               AGAAAUAGACC
AL591789.1/35311-34896               AGGGCAUUCCG
AL591788.1/218367-218154             AUAGACCGGCC
AF010496.1/116971-117194             UGGCGUCGCAA
AF010496.1/105318-105541             GGAUUUCGGGC
AF010496.1/39869-39652               UCAUCAACCGC
AF193754.1/24966-24788               AUCGUUCCACG
AF193754.1/4343-4142                 AAGUCAUCCAC
AL646079.1/157144-156965             UCUGUCGACGU
AL646070.1/4253-3997                 UGGGUUUCAGA
AE016915.1/175048-174863             GUGUCGACGCA
AE016911.1/218236-218501             CCCCGGCCGGA
BX321858.1/81804-81577               AUAUCAUGUUA
AE015548.1/1057-1279                 GUUUUCGCUGC
AE015526.1/127-357                   UGUUUUUGAGA
M10112.1/56-247                      GUCGCAUCUGG
AE016770.1/161998-162188             GUCGCAUCUGG
AJ278144.1/22351-22163               GUCGCAUCUGG
BX571869.1/30799-30632               CACGAGACAUU
M57569.1/218-26                      GUCGCAUCUGG
L12006.1/1016-1191                   GAUAACCAACA
M89481.1/311-504                     GUCGCAUCUGG
AL627279.1/139350-139157             GUCGCAUCUGG
AE008893.1/4980-5173                 GUCGCAUCUGG
AE016990.1/90583-90393               GUCGCAUCUGG
AJ414159.1/142249-141989             ACGUCGCAAUA
M34485.1/360-150                     UCUAUCCACUC
AE004721.1/1492-1697                 CCUGUUCCUCG
AE016783.1/50062-49864               AUUCACCAACC
AE004721.1/1433-1242                 UCCCGUGGCGC
AE016783.1/53812-53604               UCACUUGGCAA
AE016787.1/55358-55152               GUUUUCGACUU
AE016786.1/232051-232274             CAUGAACACCC
AE004716.1/11608-11412               CCAGUCGCGAG
AE004717.1/4221-4426                 CCCUGUUGGCA
AE016780.1/58096-58317               GCCAACGGCAU
AE016800.1/261827-262025             GAGCAAACACU
AE004105.1/5235-5438                 GAGUUAUGCAG
AE012421.1/6485-6262                 UUGACCCGGCA
AE011604.1/13614-13434               AUUCCUGAAAG
AE011315.1/3428-3605                 AAAACAAACUA
AE017248.1/199120-198939             GACUAAGCCUU
AE017249.1/124649-124462             AUAAGGGUAAA
AE017252.1/282498-282294             AUUACGAAAUC
AK109157.1/8-245                     AUGGGAGCCGG
U27616.3/1255-1032                   GUCACCCAUGG
#=GC SS_cons                         ...........
//

Department of Computer Science and Information Engineering, National Central University, Tao-yuan, Taiwan
Contact with site administrator:
Tzu-Hao Chang