RNALogo - a new approach to display structural RNA alignment
Home CreateLogo Gallery Documentation Help

► The RNALogo of RF00234 family:
 


See detail values
See the detail description of RF00234 in Rfam
 

► The SequenceLogo of RF00234 family:

► Reset display of RNALogo of RF00234 family:
 Family sequences selection : Seed ( 11 seqs.) Full ( 44 seqs.)
 Output image format :  
 Output image size :   x pixel

 


► The sequences in RF00234 family:
# STOCKHOLM 1.0

#=GF AC   RF00234
#=GF ID   glmS
#=GF DE   glmS glucosamine-6-phosphate activated ribozyme
#=GF AU   Winkler WC, Nahvi A, Roth A, Collins JA, Barrick JE, Breaker RR
#=GF SE   Barrick JE, Breaker RR
#=GF SS   Published; PMID:00000000
#=GF GA   50.00
#=GF TC   71.83
#=GF NC   33.65
#=GF TP   Cis-reg; riboswitch;
#=GF BM   cmbuild CM SEED
#=GF BM   cmsearch --local -W 300 CM SEQDB
#=GF RN   [1]
#=GF RM   15029187
#=GF RT   Control of gene expression by a natural metabolite-responsive
#=GF RT   ribozyme.
#=GF RA   Winkler WC, Nahvi A, Roth A, Collins JA, Breaker RR;
#=GF RL   Nature 2004;428:281-286.
#=GF RN   [2]
#=GF RM   16699515
#=GF RT   Backbone and nucleobase contacts to glucosamine-6-phosphate in the
#=GF RT   glmS ribozyme.
#=GF RA   Jansen JA, McCarthy TJ, Soukup GA, Soukup JK;
#=GF RL   Nat Struct Mol Biol. 2006;13:517-523.
#=GF RN   [3]
#=GF RM   16784238
#=GF RT   Evidence for preorganization of the glmS ribozyme ligand binding
#=GF RT   pocket.
#=GF RA   Hampel KJ, Tinsley MM;
#=GF RL   Biochemistry. 2006;45:7861-7871.
#=GF CC   This entry contains a glucosamine-6-phosphate activated ribozyme
#=GF CC   that is found in the mRNA for GlmS.  GlmS is an enzyme that uses
#=GF CC   fructose-6-phosphate and glutamine to generate glucosamine-6-phosphate.
#=GF CC   The ribozyme catalyses self cleavage of the glmS mRNA that is
#=GF CC   thought to regulate GlmS activity [1]. 
#=GF SQ   11

AB006424.1/2989-3156                 CCUAUAAUUAUAGCGCCCGAACUAAGCGCC....................
AE017024.1/157527-157682             UAAAUUAUAGAAGCGCCAGAACUACA........................
AE016998.1/163176-163331             UAAAUUAUAAAAGCGCCAGAACUACA........................
AL596166.1/50734-50929               AACUGAAUAGAAGCGCCAGAACUGAUUGGG....................
AF270378.1/2268-2051                 UUAAUAAUUAAAGCGCCUGUGCAAAAUACCUAAAUAGUUAUCAAGUAUUA
AC078934.3/32621-32405               AGUACAGUUAAAGCGCCUGUGCAAAUAAAUAUUUGUAUUUGAAGAUUAA.
AE015944.1/292739-292466             AAAUAUAAUAAAGCGCCAGGACUUAGGUGAUGAAACUCAGACUAUGGUCU
AE007529.1/66-225                    AUUAUAGUUAAAGCGCCCGAACUUGAGUGA....................
AE013165.1/2616-2459                 UUUAAUUUAGAAGCGCCUGGACUUAAAGCC....................
AE016953.1/223108-222961             CAAUAUCGGAUAGCGCCAGACCUGA.........................
AL935254.1/94449-94600               UAAAGCGGAAUAGCGCCAGGACUUUAG.......................
#=GC SS_cons                         ...................<<<<<<<<<<<....................

AB006424.1/2989-3156                 ..................................CGGAAAA.........
AE017024.1/157527-157682             ....................................AGUAG.........
AE016998.1/163176-163331             ....................................AAUAG.........
AL596166.1/50734-50929               ..................................ACGAAAAUG.......
AF270378.1/2268-2051                 AAA...............................GUUAAAAUA.......
AC078934.3/32621-32405               ..................................AGGUUAAUA.......
AE015944.1/292739-292466             GAGUAAGUUCGACUAACCAAAUCACAGAUUUGGAGUAAGAUUAAUGAAAC
AE007529.1/66-225                    ....................................UAUAGU........
AE013165.1/2616-2459                 .....................................UUAA.........
AE016953.1/223108-222961             .....................................ACGU.........
AL935254.1/94449-94600               .....................................AAU..........
#=GC SS_cons                         ..................................................

AB006424.1/2989-3156                 ..................................................
AE017024.1/157527-157682             ..................................................
AE016998.1/163176-163331             ..................................................
AL596166.1/50734-50929               .........................CUUAAAGGUGAAAUUCCUGGAAAGU
AF270378.1/2268-2051                 ...........................GUAGAACUUUUAUAGAUAACGAU
AC078934.3/32621-32405               .......................UAUGAGUGGCCUUUAUAGAGUGCAAUA
AE015944.1/292739-292466             UCAGACUAUGGUCUGAGUAAGUUCCACCAACCAAAUCACAGAUUUGGGGU
AE007529.1/66-225                    ..................................................
AE013165.1/2616-2459                 ..................................................
AE016953.1/223108-222961             ..................................................
AL935254.1/94449-94600               ..................................................
#=GC SS_cons                         ..................................................

AB006424.1/2989-3156                 .AG.GCUUAGUUGACGAGGAUGGAGG..UUAUCGA.AUU...UCG.CGGA
AE017024.1/157527-157682             .....UGUAGUUGACGAGGU.GGGGU..UUAUCGA.GAUU..UCGGCGGA
AE016998.1/163176-163331             .....UGUAGUUGACGAGGU.GGGGU..UUAUCGA.GAUU..UCGGCGGA
AL596166.1/50734-50929               AAACAAUCAGUUGACGAGGA.GGAGA.UUAAUCGA.AAUU..UCGGCGGG
AF270378.1/2268-2051                 UUGGAUUUUGUAGACGAGGA.GGAUAG.UGAUCGA.AUCAGAUCGGCGGA
AC078934.3/32621-32405               UAUGUAUUUGUAGACGAGGA.GGAUAG.UGAUCGAAUAGA..UCGGCGGA
AE015944.1/292739-292466             GUCACUUAAGUUGACGAGGA.UGGGG.AGUAUCGA.AUCU..UCGGCGGG
AE007529.1/66-225                    .UCAUUUAAGUUGACGAGGA.UGGGG.AGAAUCGA.AUCU..UCGGCGGA
AE013165.1/2616-2459                 .GGCUUUAAGUUGACGAGGG.CAGGG.UUUAUCGA.GACA..UCGGCGGG
AE016953.1/223108-222961             ......UCAGGUGACGAGGAGAGAGC..UUAUCGA.AGAU..UCGGCGGG
AL935254.1/94449-94600               ....CUAAAGUUGACGAGGAUGACGU..UUAUCGA.UAA...UCGACGGG
#=GC SS_cons                         .>>>>>>>>>>>.........<<<<<.....<<<<.......>>>>....

AB006424.1/2989-3156                 U..CCUCCCGGCUGAGUGUGCAGAUCACAGCCGUAAG.AAUUUCU.UCAA
AE017024.1/157527-157682             UG.ACUCCCGGUUGU...UCAUC...ACAACCGCAA..GCUUUUACUUAA
AE016998.1/163176-163331             UG.ACUCCCGGUUGU...UCAUC...ACAACCGCAA..GCUUUUACUUAA
AL596166.1/50734-50929               AG.UCUCCCGGCUG...UGCAUG....CAGUCGUUAAGUCUUACUUACAA
AF270378.1/2268-2051                 UGCUAUCCCGGAUG...UGGCA.....CAUUCGUUAG.CUUAUUAAGUAA
AC078934.3/32621-32405               UGCUAUCCCGGAUG...UGGCU.....CAUUCGUUAG.CUUAUUAAGUAA
AE015944.1/292739-292466             UG.CCCCACGGUA....CUGCAC.....UACCGUUAAAGAUUGA...CAA
AE007529.1/66-225                    UG.CCCCACGGUA....CCGCAC.....UACCGUUAGCGGUUGG...UAA
AE013165.1/2616-2459                 UG.CCCUGCGGUC....UUCCUG....CGACCGUUAGAGGACUG..GUAA
AE016953.1/223108-222961             UG.GCUCUAGGG.....ACUGCA......CUCUACA..GAUAACAAAGAA
AL935254.1/94449-94600               UG.ACGUCAGGG.....ACUGCA......CUCUACA..GGUCAAUUACAA
#=GC SS_cons                         ...>>>>><<<<<<.............>>>>>>.....<<<<<<<<....

AB006424.1/2989-3156                 ACCAAGGGGGUGACUCCUUGAACAAAG..AGAAAUCACAUGAUCUU
AE017024.1/157527-157682             AUCAUUAAGGUGACUUAGUGGACAAAG.GUGAAAGUGUGAUGAGAG
AE016998.1/163176-163331             AUCAUUAAGGUGACUUAGUGGACAAAG.GUGAAAGUGUGAUGAGAG
AL596166.1/50734-50929               AUCAUUUGGGUGACCAAGUGGACAGAG.UAGUAAUGAAACAUGUGC
AF270378.1/2268-2051                 AUCAUUAAGGUGACUUAGUGGACAAAG.UUAAUAAGAUCGCCAAAC
AC078934.3/32621-32405               AACAUUAGGGUGACUUAAUGGACAAAG.UUAAUAAGAUCGCCAGAA
AE015944.1/292739-292466             AACCAAGGAGUAAUUUUUGGUACAAA....UCAAUCAGGUGUUAAA
AE007529.1/66-225                    AAGCAGAAAGUGAUUUCUGUCACAAAG...CCAAUCUGGUGUUAAA
AE013165.1/2616-2459                 AA.CCACAGGCGACUGUGG.CAUAGAG...CAGUCCGGGCAGGAAA
AE016953.1/223108-222961             AAACUAAUUGUGAAGUUAGA.ACAAAG.CGGUUAUCACGCAGGUAG
AL935254.1/94449-94600               AAACCGACUGUGAGGUUGGUGACAGAUAUAUUGACCACGCAGCUAG
#=GC SS_cons                         ..<<<<<<<....>>>>>>>........>>>>>>>>..........
//

Department of Computer Science and Information Engineering, National Central University, Tao-yuan, Taiwan
Contact with site administrator:
Tzu-Hao Chang