RNALogo - a new approach to display structural RNA alignment
Home CreateLogo Gallery Documentation Help

► The RNALogo of RF00442 family:
 


See detail values
See the detail description of RF00442 in Rfam
 

► The SequenceLogo of RF00442 family:

► Reset display of RNALogo of RF00442 family:
 Family sequences selection : Seed ( 11 seqs.) Full ( 35 seqs.)
 Output image format :  
 Output image size :   x pixel

 


► The sequences in RF00442 family:
# STOCKHOLM 1.0

#=GF AC   RF00442
#=GF ID   ykkC-yxkD
#=GF DE   ykkC-yxkD leader
#=GF AU   Moxon SJ
#=GF SE   Barrick JE, Breaker RR
#=GF SS   Predicted; Barrick JE, Breaker RR
#=GF GA   50.00
#=GF TC   54.80
#=GF NC   20.54
#=GF TP   Cis-reg;
#=GF BM   cmbuild CM SEED
#=GF BM   cmsearch -W 200 CM SEQDB
#=GF RN   [1]
#=GF RM   15096624
#=GF RT   New RNA motifs suggest an expanded scope for riboswitches in
#=GF RT   bacterial genetic control.
#=GF RA   Barrick JE, Corbino KA, Winkler WC, Nahvi A, Mandal M, Collins J, Lee
#=GF RA   M, Roth A, Sudarsan N, Jona I, Wickiser JK, Breaker RR;
#=GF RL   Proc Natl Acad Sci U S A 2004;101:6421-6426.
#=GF CC   This family represents a conserved RNA structure found upstream
#=GF CC   of the ykkC and yxkD genes in Bacillus subtilis and related genes
#=GF CC   in other bacteria. The function of this family is unclear
#=GF CC   although it has been suggested that it may function to switch on
#=GF CC   efflux pumps and detoxification systems in response to harmful
#=GF CC   environmental molecules [1]. The Thermoanaerobacter tengcongensis
#=GF CC   sequence EMBL:AE013027 overlaps with Rfam:RF00167 suggesting that
#=GF CC   the two riboswitches may work in conjunction to regulate the the
#=GF CC   upstream gene which codes for Swiss:Q8RC62, a member of
#=GF CC   Pfam:PF00860 (Moxon SJ, pers. obs.).
#=GF SQ   11

BX569692.1/338223-338321             GGCGGAGAAACCUAGGGUUCCGAUCCC.GUCA..GGGAUGCCUG.GUCCG
Z99123.2/178321-178219               ACAGUGGUUUUCUAGGGUUCCGCAAU..GCAA...AUUGGACUGUGACCG
D78189.1/4535-4646                   UGUAAAGUUUUCUAGGGUUCCGCAUGUCAAUU.GACAUGGACUG.GUCCG
AB016894.1/3319-3421                 AGAAAGGUUUUCUAGGGUUCCGCGGCUGCUUUGUGGCCGGCCUGUGACCG
AE013027.1/8323-8427                 UGAAAGUGUACCUAGGGUUCCAGCCUG.GCAA..CAGGCGUUCG.GUCCG
BX572597.1/165163-165059             AGAGUUGGUGGCUAGGGUUCCGGCCUG..UUU..CAGGCG.CUG.GUCCG
AY316747.1/71407-71301               GCAGAUG.UUUCUAGGGUUCCGAUGCC.GUCAG.GGCAUGUCUG.GACCG
AF116356.1/182-293                   UGAGUUGGUGGCUAGGGUUCCGGCGUUUUUCUGAAGCGCGACUG.GUCCG
BX321864.1/214203-214101             GUUUCACGAAACUAGGGUUCCGGCUUUCCCAGGGAAAGUGACUG.GUCCG
BX321864.1/214421-214524             AUUACUUCAGGCUAGGGUUCCGGCUUUCCCAGGGAAAGUGACUG.GUCCG
BX571660.1/22706-22807               CGAACAGAUGGCUAGGGUUCCGAUGAUCGCUU.GAUCAUG.CUG.GUCCG
#=GC SS_cons                         ......<<<<<<<.........<<<<<<.....>>>>>>...........

BX569692.1/338223-338321             AGAGGUUUCGGUCGG.....UUCUG......CCGGCUGCACGG.AGGGAC
Z99123.2/178321-178219               AGAGAAAACACAUAGCAGC.UUG....GCUGUUAUG.ACACGG.UGGGAU
D78189.1/4535-4646                   AGAGAAAACACAUACGCGUAAAUAGAAGCGCGUAUGCACACGG.AGGGAA
AB016894.1/3319-3421                 AGAGAAAACGCGCG.G....CAUU......CUCGCGUACACGG.AGGGAC
AE013027.1/8323-8427                 AGCGGUACA.GGUAUAUGG.GUUU...CCAUAUACC.ACACCUUAGGGAU
BX572597.1/165163-165059             AGAGCUGCCCCCCGAAGGGAGAAA...UCCUUCGGACGCACGG.CGGGAC
AY316747.1/71407-71301               AGAGAAA.CCUCCGGUGGGGAGACA..UCCACCGGGUCCACGG.CGGGAU
AF116356.1/182-293                   AGAGCCACC.ACCGGCGGAGGAGAAAACCCGUCGGGUGCACGG.CGGGAC
BX321864.1/214203-214101             AGAGUUUCGGGCCCUG....CCAG......CAGGGUUCCACGG.AGGGAU
BX321864.1/214421-214524             AGAGCUUGAGGCUUCGU...CAU......ACGAAGCUCCACGG.AGGGAU
BX571660.1/22706-22807               AGAGCUAUCGGCCUCU...UGAGU......AGAGGUUACACGG.AGGGAU
#=GC SS_cons                         ..>>>>>>>.<<<<<<<<<........>>>>>>>>>..............

BX569692.1/338223-338321             AAAAGCCCGGGAGAC
Z99123.2/178321-178219               AAAAGCCCAGGAGUU
D78189.1/4535-4646                   AAAAGCCCGGGAGAG
AB016894.1/3319-3421                 AAAAGCCCGGGAGGA
AE013027.1/8323-8427                 AAAAGCCCGGGAGGA
BX572597.1/165163-165059             AAAAGCCCGGGAGAC
AY316747.1/71407-71301               AAAAGCCCGGGAGGC
AF116356.1/182-293                   AAAAGCCCGGGAGAC
BX321864.1/214203-214101             AAAAGCCCGGGAGGU
BX321864.1/214421-214524             AAAAGCCCGGGAGGU
BX571660.1/22706-22807               AAAAGCCCGGGAGGU
#=GC SS_cons                         ...............
//

Department of Computer Science and Information Engineering, National Central University, Tao-yuan, Taiwan
Contact with site administrator:
Tzu-Hao Chang