RNALogo - a new approach to display structural RNA alignment
Home CreateLogo Gallery Documentation Help

► The RNALogo of RF00504 family:
 


See detail values
See the detail description of RF00504 in Rfam
 

► The SequenceLogo of RF00504 family:

► Reset display of RNALogo of RF00504 family:
 Family sequences selection : Seed ( 93 seqs.) Full ( 217 seqs.)
 Output image format :  
 Output image size :   x pixel

 


► The sequences in RF00504 family:
# STOCKHOLM 1.0

#=GF AC   RF00504
#=GF ID   Glycine
#=GF DE   Glycine riboswitch
#=GF PI   gcvT;
#=GF AU   Moxon SJ
#=GF SE   Barrick JE, Breaker RR
#=GF SS   Predicted; Barrick JE, Breaker RR
#=GF TP   Cis-reg; riboswitch;
#=GF GA   23.00
#=GF TC   23.26
#=GF NC   22.80
#=GF BM   cmbuild CM SEED
#=GF BM   cmsearch -W 250 CM SEQDB
#=GF RN   [1]
#=GF RM   15472076
#=GF RT   A glycine-dependent riboswitch that uses cooperative binding to
#=GF RT   control gene expression.
#=GF RA   Mandal M, Lee M, Barrick JE, Weinberg Z, Emilsson GM, Ruzzo WL,
#=GF RA   Breaker RR;
#=GF RL   Science 2004;306:275-279.
#=GF CC   This family represents the bacterial glycine riboswitch. Glycine
#=GF CC   riboswitches usually consist of two metabolite-binding aptamers
#=GF CC   domains with similar structures in tandem. The aptamers
#=GF CC   cooperatively bind glycine to regulate the expression of
#=GF CC   downstream genes. In Bacillus subtilis, this riboswitch is found
#=GF CC   upstream of the gcvT operon which controls glycine
#=GF CC   degradation. It is thought that when glycine is in excess it will
#=GF CC   bind to both aptamers to activate these genes and facilitate
#=GF CC   glycine degradation [1].
#=GF SQ   93

AE017232.1/187112-187234               .....UGCCU.CUG.GAAAGCGGUGCCGG.............CCCUCGGG
AE017232.1/187012-187109               CGCAUUCGAG.CGG.GAGAGUUCCGUGACGGCCA........GUCA....
BX842577.1/344457-344587               .....UGCCU.CUG.GAAAGCGGUGGC...............GACCCCUG
AE000516.2/79183-79076                 .....CAACU.CUG.GAGACAGGGACG...............GUCGCACC
BX842577.1/344356-344453               CGCUCUAGUG.CGG.GAGAGUUCUGUGGCUG...........CCAGC...
AE000516.2/79275-79185                 UGACGCGAUG.UGG.GAGAA.CCUCC................AUGUC...
AJ301559.2/6878-7012                   UUCGACAACU.CUG.GAAAGUGGUGGGA..............GCACC...
AJ301559.2/6784-6876                   CGCCUGCGCG...G.GAGAGUUCCGAGGC.............AUCCAGU.
AE016822.1/1714518-1714420             GAGGCCGAUG.CGG.GAGAGCUGCGGG...............GGAGAACC
AE016822.1/1714418-1714292             .....CCACU.CUG.AAAAGCAGG..................GCAGCGUC
AL939108.1/255442-255325               .....UCACU.CUG.GAAAGCAGGGCGGGU............GUCGACGG
AL939123.1/278145-278052               UGAAUCCGCG.CGG.GAGAGUCCCCGG................CCGCG..
AL939123.1/278050-277936               .....CACAU.CUG.AAAAGCGGACCGCC.............CCCGACGG
AL939108.1/255539-255444               UGACCCCGCG.CGG.GAGAGUCCUCCGGAC............AUCAC...
D84432.1/169999-170100                 AUGACAGCAA.GGG.GAGAGACCUGACC..............GAAAACCU
AE017005.1/149900-149799               AUGAACCAUU.CAG.GAGAA.GGUC.................UAUU....
AE017355.1/2242861-2242742             GGACGAAUCU.CUG.GAGAGACUCCCUCUCGCU.........UUAAAUAG
AE017355.1/2242962-2242862             AUGAACCAUU.CAG.GAGAA.GGUC.................UAUU....
AE017271.1/283102-282983               GGACGAAUCU.CUG.GAGAGACUCCCUCUCGCU.........UUAUAUAG
AL596168.1/161626-161717               GUGAAUGUAA.ACA.GAGAGACUG..................UGAAA...
AL591978.1/212840-212931               GUGAAUGUAA.GCA.GAGAGACUGC.................GAAAA...
AE017326.1/175321-175412               GUGAAUGUAA.GCA.GAGAGACUGC.................GAAAA...
AE016748.1/54065-53923                 UUGAUCAGUA.UUA.GAGAGAAUAGAGA..............UCAAAACU
AE015942.1/292344-292250               .....AAACU.CUG.GAGAGACUCUUUU..............UUAUA...
AE007658.1/8894-8810                   .....AACCC.UUG.GAGAGACUC..................UUAAA...
AE015942.1/117166-117273               UUGAAGAGUA.UAA.GAGAGAUCCUAU...............UUUAA...
AJ276209.1/792-890                     AUGAAGAGCA.AAA.GAGAGAAUC..................GUUU....
AE015942.1/292435-292345               AUGAAGGUAA.UAG.GAGAGAGGUC.................UUUU....
AE007658.1/8987-8895                   AUGAAGUUAG.CGG.GAGAGCUUUGGCU..............UUUGC...
AJ312125.1/523-454                     AUGAAGGUGG.CAG.GAGAGACCC...................AUGA...
AJ312125.1/453-315                     AGACGAUACU.CUG.GAGAGACCA..................UAUA....
AE013002.1/8534-8441                   .....GGCCU.CUG.GAAAGUCUC..................GUAAA...
AE013002.1/8645-8535                   AUGAAGAUAG.CGA.GAGAUUAUCUUCC..............AUAAAUG.
AE013139.1/7699-7613                   .....AUAUC.CCG.GAAAG.CCUC.................UAAA....
AE013139.1/7801-7700                   AUGAAGAAUG.CGG.GAGAGACCC..................UAACC...
AE006566.1/2765-2849                   UGAUGUCAUG.CAG.GAGAA.GAA..................UUUU....
AE014954.1/5814-5899                   UGACGGACUU.CUG.GAGAGACC...................UACUA...
AE008417.1/5102-5190                   GGACGGAACU.CUG.GAGAGACC...................GUAAA...
AE006566.1/2851-2932                   .....GACUU.CUG.GAGAGACCU..................UAUU....
AE010046.1/2764-2849                   UGAUGUCAUG.CAG.GAGA..AGAA.................UUUA....
AL766849.1/65640-65772                 AGACGGACUU.CUG.GAGAGACCUA.................UAAGUAGC
AL766849.1/65560-65639                 UGACGUCAUU.CAG.GAGAAGAAAG.................UUAGA...
AE006003.1/9570-9465                   .....GAACG.CUG.GAAAGCAGAGCG...............CGCGC...
AE005997.1/1861-1775                   UCGACCCUCG.CGG.GAGACAUCGGGA...............UUCGA...
AE006003.1/9660-9572                   AGGCCUCUCG.CGG.GAGAGAUCGGGC...............CUUGC...
AE005997.1/1774-1655                   UUUAGGAACG.CUG.GAAAGCAGUCUC...............UCCACCGG
BX897699.1/1435970-1435876             .....UUUUG.CGG.GAGAGUGCAGGC...............UGCAAGUU
BX897699.1/1435871-1435783             .....CAGAU.CUG.GAAAGUCGG..................GAGG....
BX572605.1/160757-160849               CGACUGACAU.CUG.GAAAGAGACCCUGCCGGGC........GAUCCCGG
BX572605.1/160670-160756               CUAAGUCGCGUCGG.GAGAGAUCGGCC...............GCAA....
AE009691.1/7488-7590                   UAAGACAACU.CUG.GAAAGUCGGGGG................CAAC...
AE008071.1/8587-8502                   CGCAUCAUCG.UUGGGAGAAACCGC.................UUCA....
AE008071.1/8501-8413                   CGACGGAACU.CUG.GAGAGAAGCCAC...............CUUGACUA
AL591787.1/222640-222555               CGACCUCGUU..GG.GAGAAACCGG.................UUCGA...
BX640425.1/120361-120480               AAACAGCACU.CUG.GAGAGACCUGGCGUGGCCACC......UUCGCGGU
BX640445.1/160122-160016               .....AACAU.CUG.GAGAGUGGCGCGCG.............GUAC....
BX640439.1/206557-206676               AAACAGCACU.CUG.GAGAGACCUGGCGCGGCCACC......UUCGCGGU
BX640439.1/206443-206535               ACGCAUGUCG.CGG.GAGAGAGCGGCCG..............AUUGC...
BX640445.1/160210-160126               ACGUGCAGUU.CGG.GAGAGACCGU.................CCAGC...
AL646074.1/141575-141672               GCCAUCCAUC.CGG.GAGAGCGCGUCGGCC............GCAUACGG
AL646074.1/141686-141809               CGGCCGCACU.CUG.GAGAGCGGCGCCGC.............GUCACCAU
AE016917.1/68424-68339                 UCCGGUUCUG.CGG.GAGAGAGGGGCC................ACG....
AE016922.1/90836-90738                 UUCGCGCAAU.CUG.GAGAGCGGCG.................UCCGCGC.
AE016917.1/68334-68236                 AUCAAGCCGA.UUG.GAGAGAGGCCGC...............CCCGC...
AE016922.1/90941-90851                 CCGGGUCAUA.CAG.GAGAGAGCGGCU...............UUCU....
AL162754.2/59297-59394                 GGGAAAUGUG.CAG.GAGAGUGUUACACCCAAC.........UACAA...
AL162754.2/59398-59550                 .....ACAAU.CUG.GAGAGCGGCGUUGG.............AAUAA...
BX321858.1/45114-45207                 .....GCAAU.CUG.GAGAGUGCUG.................AAACAGC.
BX321858.1/45005-45113                 UUCAUCCAGG.CAG.GAGAGUGCGCUG...............UAUCAAAA
CR522870.1/1448610-1448703             AUGAACAUAG.CAG.GAGAGAUUUU.................UCCCAUGG
CR522870.1/1448704-1448793             .....AGCCU.CUG.GAGAGUCUC..................AUUAU...
AE017311.1/207809-207719               .....AGCCU.CUG.GAGAGACCCC.................GCAA....
AE017311.1/207890-207810               AUGACGACAG.CAG.GAGAGACCUCCC...............CCAGA...
AE015530.1/8809-8928                   AUGAAGGUAG.CAG.GAGAGUGGGGA................AUUAA...
AE015530.1/8929-9047                   .....AGCCU.CUG.GAGAGACUACCGAUUGCA.........UUAACUUG
BX950851.1/2645129-2645034             UUGAAGCCAA.CUG.GAGAGAGGUUGC...............GAUGC...
BX950851.1/2645260-2645133             CCGCUCCUCG.CAG.GAGAGAGGGCGUGUACUCCAGCAUAC.UUCAAGCU
U32770.1/3645-3566                     AUGAAGGUAG.CUG.GAGAGCGGGAA................AUUGA...
U32770.1/3564-3455                     GGACGAACCC.UUG.GAGAGAUCCAUU...............UUAGA...
AE017152.1/58537-58646                 .....AACCC.UUG.GAGAGAUCCACUCUGUACUAUAGUACAGAAAA...
AE006044.1/6136-6252                   .....AACCC.UUG.GAGAGAGCCG.................UUAUAUUA
AE006044.1/6045-6135                   AUGAAGGUAG.CUG.GAGAGUAGGGA................AUUGA...
CR543861.1/1990167-1990077             AUGAUUAUUG.CAG.GAGAGAUAUUCU...............UGCAA...
CR543861.1/1990073-1989965             .....AUAAU.CUG.GAGAGAAGUAUU...............UCAAA...
CR378670.1/15794-15904                 .....AGCCU.CUG.GAGAGACCCG.................UUAAA...
CR378670.1/15611-15793                 AUGAAGAUAG.CAG.GAGAGUGGCA.................UAUUAUUC
AE004221.1/2349-2255                   .....AACCU.CUG.GAGAGAACCG.................UUUAA...
AE004221.1/2485-2350                   UUGAAGACUG.CAG.GAGAGUGGUU.................GUUAACCA
AE016806.1/33242-33376                 AUGAAGGCUA.CAG.GAGAGUGGUAA................UUAACCAU
AE012210.1/6050-5969                   GUAACACGGU..GG.GAGAA.GCGGC................ACUG....
AE012210.1/5968-5859                   .....CAACU.CUG.GAGAGACCGG.................UUCA....
AE011751.1/9456-9347                   .....CAACU.CUG.GAGAGACCGGCC...............GAUG....
AE011751.1/9538-9457                   GCAACACGGU..GG.GAGAA.GCGGC................ACUG....
#=GC SS_cons                           .....<<<<<.<<<.......<<<<.........................

AE017232.1/187112-187234               CC............................................CGCA
AE017232.1/187012-187109               ................................................CG
BX842577.1/344457-344587               GCGGUC........................................CUCA
AE000516.2/79183-79076                 GACC..........................................GUGC
BX842577.1/344356-344453               ..............................................UACG
AE000516.2/79275-79185                 ................................................GA
AJ301559.2/6878-7012                   ................................................CA
AJ301559.2/6784-6876                   ..............................................CUCG
AE016822.1/1714518-1714420             CG............................................CCCG
AE016822.1/1714418-1714292             GACCCUCCGGGUCGAUCCCGCGGGACAUGCU...............GG.C
AL939108.1/255442-255325               CUUC..........................................CGCU
AL939123.1/278145-278052               ..............................................CCGG
AL939123.1/278050-277936               ..............................................CGGU
AL939108.1/255539-255444               ..............................................CGGA
D84432.1/169999-170100                 CGGGA.........................................UACA
AE017005.1/149900-149799               ................................................GA
AE017355.1/2242861-2242742             CGUAGAGGAA....................................AACG
AE017355.1/2242962-2242862             ................................................GA
AE017271.1/283102-282983               CGUAGAGGAA....................................AACG
AL596168.1/161626-161717               ..............................................AG.C
AL591978.1/212840-212931               ................................................GC
AE017326.1/175321-175412               ................................................GC
AE016748.1/54065-53923                 UGAAUCAUUAUAAGUUAAACGUUUUUAGUCUAUUACAAUUUUGACUCUCU
AE015942.1/292344-292250               ..............................................AAAG
AE007658.1/8894-8810                   .................................................G
AE015942.1/117166-117273               ................................................AG
AJ276209.1/792-890                     .................................................G
AE015942.1/292435-292345               ................................................GA
AE007658.1/8987-8895                   ................................................CA
AJ312125.1/523-454                     ...............................................G.G
AJ312125.1/453-315                     .................................................A
AE013002.1/8534-8441                   .................................................G
AE013002.1/8645-8535                   ..............................................GAAG
AE013139.1/7699-7613                   ................................................GA
AE013139.1/7801-7700                   .................................................G
AE006566.1/2765-2849                   .................................................U
AE014954.1/5814-5899                   ..................................................
AE008417.1/5102-5190                   ..................................................
AE006566.1/2851-2932                   .................................................A
AE010046.1/2764-2849                   ................................................UU
AL766849.1/65640-65772                 AACAUCUUUGUAUUGACACCAAGAUGUGC.................UCUA
AL766849.1/65560-65639                 ................................................CU
AE006003.1/9570-9465                   ..............................................CGCU
AE005997.1/1861-1775                   ..............................................UCCC
AE006003.1/9660-9572                   ................................................CC
AE005997.1/1774-1655                   A.............................................GGGG
BX897699.1/1435970-1435876             UUUGG.........................................GUCU
BX897699.1/1435871-1435783             ..............................................GG.C
BX572605.1/160757-160849               GA............................................CGGG
BX572605.1/160670-160756               ..............................................GGCC
AE009691.1/7488-7590                   ................................................UC
AE008071.1/8587-8502                   ..............................................UUGC
AE008071.1/8501-8413                   AAGG..........................................ACGG
AL591787.1/222640-222555               ...............................................UCC
BX640425.1/120361-120480               GCGCAAGCAG....................................CCCA
BX640445.1/160122-160016               ..............................................GGCG
BX640439.1/206557-206676               GCGCAAGCAG....................................CCCA
BX640439.1/206443-206535               ..............................................GGCU
BX640445.1/160210-160126               ..............................................GGAC
AL646074.1/141575-141672               CC............................................AGUC
AL646074.1/141686-141809               CGCG..........................................GGCG
AE016917.1/68424-68339                 ................................................CC
AE016922.1/90836-90738                 ..............................................GACG
AE016917.1/68334-68236                 ..............................................GCGG
AE016922.1/90941-90851                 ..............................................GGCC
AL162754.2/59297-59394                 ..............................................UGUA
AL162754.2/59398-59550                 ................................................CG
BX321858.1/45114-45207                 ..............................................UUCA
BX321858.1/45005-45113                 UA............................................CAGU
CR522870.1/1448610-1448703             CAGUACGGAUGG..................................GGAA
CR522870.1/1448704-1448793             .................................................G
AE017311.1/207809-207719               ................................................GG
AE017311.1/207890-207810               ..............................................GGGA
AE015530.1/8809-8928                   ................................................CC
AE015530.1/8929-9047                   CAAUAAU.......................................AGGU
BX950851.1/2645129-2645034             ................................................AA
BX950851.1/2645260-2645133             ACAUGUACGUUGGCAUAAAGUAUA......................ACGC
U32770.1/3645-3566                     ................................................CC
U32770.1/3564-3455                     ..............................................AAUG
AE017152.1/58537-58646                 ................................................UG
AE006044.1/6136-6252                   AAAAGAGAUAA...................................AACG
AE006044.1/6045-6135                   ................................................CC
CR543861.1/1990167-1990077             ..............................................AGGA
CR543861.1/1990073-1989965             ..............................................AAUA
CR378670.1/15794-15904                 ...............................................UCG
CR378670.1/15611-15793                 GCUAGCAGAAUCAUUCUGAUACGAGUA...................UAAG
AE004221.1/2349-2255                   ...............................................UCG
AE004221.1/2485-2350                   GAUUUUAACAUCUGAGCCAA..........................AUAA
AE016806.1/33242-33376                 AUUUUAACAUUUGGUUAGU...........................CAUA
AE012210.1/6050-5969                   ................................................CC
AE012210.1/5968-5859                   ..............................................CUCC
AE011751.1/9456-9347                   ................................................CC
AE011751.1/9538-9457                   ................................................CC
#=GC SS_cons                           ................................................>>

AE017232.1/187112-187234               CC.CGCCGAUGGGGA..AA.GGCGG.........................
AE017232.1/187012-187109               GA.CGCCGAAGGAGC..AACACCUC.........................
BX842577.1/344457-344587               CC.CGCCGAUGGGGA..AA.GGCGAUU.......................
AE000516.2/79183-79076                 CU.GACCGAAGGUGU..AGAGCGGC.........................
BX842577.1/344356-344453               GA.CGCCGAAGGAGC..AAUACCUC.........................
AE000516.2/79275-79185                 GG.CGCCGUAGGAGC..AA.UCUCCU........................
AJ301559.2/6878-7012                   CC.CGCCCAAGGGGA..AA.GGUGCCGGU.....................
AJ301559.2/6784-6876                   GA.CGCCGAAGGAGC..AAUACCUC.........................
AE016822.1/1714518-1714420             CGGCACCGAAGGAGC..AA.UCCUC.........................
AE016822.1/1714418-1714292             CU.CGCCCACGGUGA..AA.GCCGC.........................
AL939108.1/255442-255325               CU.CACCGACGGUGA..AA.GCCGGGCAGAGC..................
AL939123.1/278145-278052               GG.CGCCGAAGGAGC..AA.GUCCC.........................
AL939123.1/278050-277936               CC.CACCCAAGGUGC..AA.GCCCUGA.......................
AL939108.1/255539-255444               GG.CGCCGAAGGAGC..AA.AUCCU.........................
D84432.1/169999-170100                 GG.CGCCGAAGGAGC..AA.ACU...........................
AE017005.1/149900-149799               UC.UACCGACGGGGC..AA.AAAGUUGUUA....................
AE017355.1/2242861-2242742             AG.CACCGAAGGAGC..AAAUCCGC.........................
AE017355.1/2242962-2242862             UC.UACCGACGGGGC..AA.AAAGUUGUUAACC.................
AE017271.1/283102-282983               AG.CACCGAAGGAGC..AAAUCCGC.........................
AL596168.1/161626-161717               AG.CGCCGACGGGGA..AA.GCAUAAG.......................
AL591978.1/212840-212931               AG.CGCCGACGGGGA..AA.GCAUA.........................
AE017326.1/175321-175412               GG.CGCCGACGGGGA..AA.GCAUG.........................
AE016748.1/54065-53923                 AU.CGCCGAAGGUGC..AA.GUG...........................
AE015942.1/292344-292250               AG.CACCGAAGGAGC..AA.GUUGGGUAAA....................
AE007658.1/8894-8810                   AG.CACCGAAGGAGA..AA.GCAUAAA.......................
AE015942.1/117166-117273               GA.CGCCGAAGGGAC..AA.UCUAUGUUUA....................
AJ276209.1/792-890                     AU.CGCCGAAGGGAC..AA.GUUUAUAUUU....................
AE015942.1/292435-292345               CC.CACCGAAGAUGC..AAA..............................
AE007658.1/8987-8895                   UA.CACCGAAGAAGU..AA...............................
AJ312125.1/523-454                     GG.CGCCGAAGAAGU..AA...............................
AJ312125.1/453-315                     GG.CACCGAAGGAGC..AA.AUUUAAUUGAGAUCUUUAUAUAAAUAAAAA
AE013002.1/8534-8441                   AG.CACCGAAGGAGC..AA.UACAUAUGGAAG..................
AE013002.1/8645-8535                   AU.AGCCGAAGGGGA..AA.UACAAAG.......................
AE013139.1/7699-7613                   GG.CACCGAAGGAGC..AA.UUCUUCUAU.....................
AE013139.1/7801-7700                   GG.CGCCGAAGGAGC..AA.GCGGGUAUAUGGCCUGUAU...........
AE006566.1/2765-2849                   UU.CGCCGAAGGAGU..UA...............................
AE014954.1/5814-5899                   GG.CGCCGAAGGGGC..AA.GGCUG.........................
AE008417.1/5102-5190                   GG.CACCGAAGGGGC..AA.GGCAG.........................
AE006566.1/2851-2932                   GG.CGCCGAAGGGGC..AA.GGCAU.........................
AE010046.1/2764-2849                   UU.CGCCGAAGGAGU..UA...............................
AL766849.1/65640-65772                 GG.CGCCGAAGGGGC..AA.GAAGAGUAAAACAA................
AL766849.1/65560-65639                 UU.CGCCGAAGGAAU..UA...............................
AE006003.1/9570-9465                   CU.CGCCGAAGGAGC..AA.GGCCU.........................
AE005997.1/1861-1775                   GA.GGCCGAAGGCGC..AA.CCG...........................
AE006003.1/9660-9572                   GG.CGCUGAAGGCGA..AA.CCG...........................
AE005997.1/1774-1655                   CU.CGCCGAAGGAGC..AA.GGCCAA........................
BX897699.1/1435970-1435876             GC.CGCCGAAGGGGA..AA.AUA...........................
BX897699.1/1435871-1435783             CG.CGCCGAAGGUGU..AA.GCGAA.........................
BX572605.1/160757-160849               UC.CGCCGACGGGAU..AA...............................
BX572605.1/160670-160756               GG.CGCCGAAGGAGC..AA.CCG...........................
AE009691.1/7488-7590                   CG.CGCCGAAGGUGU..AA.GUAUGGCUUUAUAUAUA.............
AE008071.1/8587-8502                   GG.UGCCGAAGGAGC..AA.CCG...........................
AE008071.1/8501-8413                   CU.CGCCGAAGGGAU..AA...............................
AL591787.1/222640-222555               GG.UGCCGAAGGAGC..AA.CCG...........................
BX640425.1/120361-120480               GG.CGCCGAAGGUGC..AAACCCGC.........................
BX640445.1/160122-160016               CC.CACCGAAGGGGA..U..CCCUG.........................
BX640439.1/206557-206676               GG.CGCCGAAGGUGC..AAACCCGC.........................
BX640439.1/206443-206535               GC.CGCCGAAGGCGC..AA.UUC...........................
BX640445.1/160210-160126               GG.CGCCGACGGAGC..AA.CCA...........................
AL646074.1/141575-141672               GC.CGCCGAAGGGGU..AG.C.............................
AL646074.1/141686-141809               CC.CACCGAAGGGGCUCAC.GGAACCG.......................
AE016917.1/68424-68339                 CC.CGCCGAAGACGC..AA.GC............................
AE016922.1/90836-90738                 CC.CACCGAAGGGGC..UAACGGCUUA.......................
AE016917.1/68334-68236                 CC.CACCGAAGGGGC..AA.GUGGCCUAAG....................
AE016922.1/90941-90851                 GC.CGCCGAAGGCGC..AA.GCGCA.........................
AL162754.2/59297-59394                 AC.CACCGAAGGCGC..A..GAC...........................
AL162754.2/59398-59550                 UC.CACCGAAGGGGA..GAAGGCCGUCUGAAC..................
BX321858.1/45114-45207                 GC.CACCGAAGGGGC..AU.GCGGAAAGUU....................
BX321858.1/45005-45113                 GU.CACCGAAGGCGU..AA.CC............................
CR522870.1/1448610-1448703             GG.CACCGAAGAAGU..AA...............................
CR522870.1/1448704-1448793             GG.CACCGAAGGAGC..AA.GCCAGCGUGUA...................
AE017311.1/207809-207719               GG.CACCGAAGGAGC..AA.GCCGC.........................
AE017311.1/207890-207810               GG.CGCCGACGAAGU..AA...............................
AE015530.1/8809-8928                   CCACACCGACGAGGC..AA.CUUUGUUGUUGGAAGCAU............
AE015530.1/8929-9047                   GG.CGCCGAAGGCGA..AA.GUG...........................
BX950851.1/2645129-2645034             CC.CACCGAAGGGGC..AA.GCAGC.........................
BX950851.1/2645260-2645133             UC.CGCCGAAGGCGC..AA.AC............................
U32770.1/3645-3566                     CCACACCGACGAUGU..AA...............................
U32770.1/3564-3455                     GA.CGCCGAA.GCGC..AA.AAGAGCGGUUAAUUUU..............
AE017152.1/58537-58646                 GA.CGCCGAAGGCGC..AA.AUAUA.........................
AE006044.1/6136-6252                   GC.CGCCGAAGGCGC..AA.AAAGA.........................
AE006044.1/6045-6135                   CUACGCCGACGAGGU..AA...............................
CR543861.1/1990167-1990077             UA.CGCCGAAGGAGC..AA.CG............................
CR543861.1/1990073-1989965             CU.CACCGAAGGGGA..UG.GUACG.........................
CR378670.1/15794-15904                 GG.CGCCGAAGGAGC..AA.GCUUU.........................
CR378670.1/15611-15793                 CC.CGCCGAAGAAGU..AA.GCGUUCUUA.....................
AE004221.1/2349-2255                   GU.CGCCGAAGGAGC..AA.GCUCU.........................
AE004221.1/2485-2350                   CC.CGCCGAAGAAGU..AA...............................
AE016806.1/33242-33376                 CC.CGCCGAAGAAGU..AA...............................
AE012210.1/6050-5969                   GC.UGCCGAAGGCGC..AA.CA............................
AE012210.1/5968-5859                   GG.CGCCGAAGGGGC..AC.GGAACGCAGGCAG.................
AE011751.1/9456-9347                   GG.CGCCGAAGGGGC..AC.GAAACGCAGGCAG.................
AE011751.1/9538-9457                   GC.UGCCGAAGGCGC..AA.CA............................
#=GC SS_cons                           >>..<<<<<..<<<......<<............................

AE017232.1/187112-187234               ......CCGC........................................
AE017232.1/187012-187109               ......UCC.........................................
BX842577.1/344457-344587               ......CACC......................................UG
AE000516.2/79183-79076                 ......GCCA........................................
BX842577.1/344356-344453               ......UCC.........................................
AE000516.2/79275-79185                 ......CCCC........................................
AJ301559.2/6878-7012                   ......GCGC.................................GCAUGUC
AJ301559.2/6784-6876                   ......CCC.........................................
AE016822.1/1714518-1714420             ......CCC.........................................
AE016822.1/1714418-1714292             ......GAAC........................................
AL939108.1/255442-255325               ......UCCA........................................
AL939123.1/278145-278052               ......UCCC........................................
AL939123.1/278050-277936               ......UCGC......................................CG
AL939108.1/255539-255444               ......CCCC........................................
D84432.1/169999-170100                 ......GCGG........................................
AE017005.1/149900-149799               ......UACC........................................
AE017355.1/2242861-2242742             ......UACU........................................
AE017355.1/2242962-2242862             ......GACU........................................
AE017271.1/283102-282983               ......UACU........................................
AL596168.1/161626-161717               ......UUAU........................................
AL591978.1/212840-212931               ......UAUU........................................
AE017326.1/175321-175412               ......UAUU........................................
AE016748.1/54065-53923                 ..................................................
AE015942.1/292344-292250               ......ACCA........................................
AE007658.1/8894-8810                   ......AAAA........................................
AE015942.1/117166-117273               ......UCCC........................................
AJ276209.1/792-890                     ......GCCA........................................
AE015942.1/292435-292345               ..................................................
AE007658.1/8987-8895                   ..................................................
AJ312125.1/523-454                     ..................................................
AJ312125.1/453-315                     AGCUCAUCCC...................................UUUUU
AE013002.1/8534-8441                   ......GCCA........................................
AE013002.1/8645-8535                   ......GCCC........................................
AE013139.1/7699-7613                   ......AAAG........................................
AE013139.1/7801-7700                   ......ACUC........................................
AE006566.1/2765-2849                   ..................................................
AE014954.1/5814-5899                   ......UUUG........................................
AE008417.1/5102-5190                   ......GCAA........................................
AE006566.1/2851-2932                   ......ACUG........................................
AE010046.1/2764-2849                   ..................................................
AL766849.1/65640-65772                 ......CUCC........................................
AL766849.1/65560-65639                 ..................................................
AE006003.1/9570-9465                   ......GCCG........................................
AE005997.1/1861-1775                   ......CCCC........................................
AE006003.1/9660-9572                   ......CCCC........................................
AE005997.1/1774-1655                   ......ACCC....................................GUCC
BX897699.1/1435970-1435876             ......GCCC........................................
BX897699.1/1435871-1435783             ......AACU........................................
BX572605.1/160757-160849               ..................................................
BX572605.1/160670-160756               ......CCCC........................................
AE009691.1/7488-7590                   ......GCCA........................................
AE008071.1/8587-8502                   ......CCCC........................................
AE008071.1/8501-8413                   ..................................................
AL591787.1/222640-222555               ......CCCC........................................
BX640425.1/120361-120480               ......UCGC........................................
BX640445.1/160122-160016               ......GCGC......................................GU
BX640439.1/206557-206676               ......UCGC........................................
BX640439.1/206443-206535               ......GCCC........................................
BX640445.1/160210-160126               ......CCCC........................................
AL646074.1/141575-141672               ......ACCC........................................
AL646074.1/141686-141809               ......UCGC........................................
AE016917.1/68424-68339                 ......UCCC........................................
AE016922.1/90836-90738                 ......UCCG........................................
AE016917.1/68334-68236                 ......GCC.........................................
AE016922.1/90941-90851                 ......CCC.........................................
AL162754.2/59297-59394                 ......ACCC........................................
AL162754.2/59398-59550                 ......CACCAUUCAGACAACCGCGCAAAGCAGUGAGCAGACUGGUUUGC
BX321858.1/45114-45207                 ......GACC........................................
BX321858.1/45005-45113                 ......CCCC........................................
CR522870.1/1448610-1448703             ..................................................
CR522870.1/1448704-1448793             ......GCUG........................................
AE017311.1/207809-207719               ......CCCA........................................
AE017311.1/207890-207810               ..................................................
AE015530.1/8809-8928                   ......UCCA........................................
AE015530.1/8929-9047                   ......UCGC........................................
BX950851.1/2645129-2645034             ......UCUG........................................
BX950851.1/2645260-2645133             ......UCCC........................................
U32770.1/3645-3566                     ..................................................
U32770.1/3564-3455                     ......UCAA........................................
AE017152.1/58537-58646                 ......AAGC........................................
AE006044.1/6136-6252                   ......GCGG........................................
AE006044.1/6045-6135                   ..................................................
CR543861.1/1990167-1990077             ......ACCC........................................
CR543861.1/1990073-1989965             ......UAGA....................................UUUA
CR378670.1/15794-15904                 ......CCUU...............................UUUGCUGUU
CR378670.1/15611-15793                 ......AACC...............................GUUUGUUAC
AE004221.1/2349-2255                   ......GCGC........................................
AE004221.1/2485-2350                   ..................................................
AE016806.1/33242-33376                 ..................................................
AE012210.1/6050-5969                   ......GCCC........................................
AE012210.1/5968-5859                   ......GCCA........................................
AE011751.1/9456-9347                   ......GCCA........................................
AE011751.1/9538-9457                   ......GCCC........................................
#=GC SS_cons                           ..................................................

AE017232.1/187112-187234               ..GACAGCAUCGGCCGCCGAAUCUCUCAGGC...................
AE017232.1/187012-187109               ................GUCAACCUCUCAGGC...................
BX842577.1/344457-344587               ACGGUGGACAGAGUCGCCGAAUCUCUCAGGC...................
AE000516.2/79183-79076                 ....UGAUGCGACGCCGC.AGACUCUCAGGU...................
BX842577.1/344356-344453               ................GUCAACCUCUCAGGC...................
AE000516.2/79275-79185                 ................GAGAAUCUCUCAGGC...................
AJ301559.2/6878-7012                   AGCGCGCCGUGUUCUACCGAAUCUCUCAGGC...................
AJ301559.2/6784-6876                   ................GUCAAUCUCUCAGGC...................
AE016822.1/1714518-1714420             ................GACAAUCUCUCAGGU...................
AE016822.1/1714418-1714292             ........GCUUCGCGGUGAAACUCUCAGGC...................
AL939108.1/255442-255325               .....GGGCUCGCCCGGUGAAGCUCUCAGGU...................
AL939123.1/278145-278052               ................UUGAAUCUCUCAGGC...................
AL939123.1/278050-277936               UACUCCGGUGGCCGUGGCGAACCUCUCAGGU...................
AL939108.1/255539-255444               ................GG.AAUCUCUCAGGC...................
D84432.1/169999-170100                 ...............AGUGAAUCUCUCAGGC...................
AE017005.1/149900-149799               ............AGCUUUGAAACUCUCAGGU...................
AE017355.1/2242861-2242742             ..........AUAGCGGAUAAUCUCUCAGGU...................
AE017355.1/2242962-2242862             ................UUGAAACUCUCAGGU...................
AE017271.1/283102-282983               ..........AUAGCGGAUAAUCUCUCAGGU...................
AL596168.1/161626-161717               ................GUGAAACUCUCAGGC...................
AL591978.1/212840-212931               ..............AUGUGAAACUCUCAGGC...................
AE017326.1/175321-175412               ..............AUGUGAAACUCUCAGGC...................
AE016748.1/54065-53923                 ...........AAAUAACGAAACUCUCAGGC...................
AE015942.1/292344-292250               ................AUGAAACUCUCAGGU...................
AE007658.1/8894-8810                   ................GCGAAACUCUCAGGU...................
AE015942.1/117166-117273               .....AAUAAAACAUAGAGAAAUUCUCAGGC...................
AJ276209.1/792-890                     .........AAUAUAAAUGAAAUUCUCAGGC...................
AE015942.1/292435-292345               ...................AAUCUUUCAGGU...................
AE007658.1/8987-8895                   ....................AUCUUUCAGGU...................
AJ312125.1/523-454                     ....................AGCUUUCAGGC...................
AJ312125.1/453-315                     UAGAUCAAGCGAUUAAAUGAAUCUCUCAGGU...................
AE013002.1/8534-8441                   ............UAUGUAGAAGCUCUCAGGU...................
AE013002.1/8645-8535                   ....GCCAAGCCUUUGUAGAAGCUCUCAGGC...................
AE013139.1/7699-7613                   ................AAGAAUCUCUCAGGU...................
AE013139.1/7801-7700                   ................GUGAAACUCUCAGGC...................
AE006566.1/2765-2849                   ....................UACUCUCAGGU...................
AE014954.1/5814-5899                   ................CUCAAACUCUCAGGC...................
AE008417.1/5102-5190                   .............CUGCUCAAACUCUCAGGU...................
AE006566.1/2851-2932                   ................CUCAAUCUCUCAGGC...................
AE010046.1/2764-2849                   ....................UACUCUCAGGU...................
AL766849.1/65640-65772                 ................UCCAAUCUCUCAGGC...................
AL766849.1/65560-65639                 ....................CACUCUCAGGU...................
AE006003.1/9570-9465                   ACUGUCUGGUCGGCCGCUGAAUCUCUCAGGC...................
AE005997.1/1861-1775                   ................GG.AAACGCUCAGGC...................
AE006003.1/9660-9572                   ................GG.AAACGCUCAAGC...................
AE005997.1/1774-1655                   GGCAGAGGGGCGAGGCCGGAAUCUCUCAGGC...................
BX897699.1/1435970-1435876             ................GU.AAUCUCUCAGGC...................
BX897699.1/1435871-1435783             ..........UUUUUCGCGAGUCUCUCAGGU...................
BX572605.1/160757-160849               ....................UGCUCUCAGGC...................
BX572605.1/160670-160756               ................GG.AAACUCUCAGGC...................
AE009691.1/7488-7590                   ...............UGCGAGUCUCUCAGGC...................
AE008071.1/8587-8502                   ................GG.AAACUCUCAGGC...................
AE008071.1/8501-8413                   ....................CAAUCUCAGGC...................
AL591787.1/222640-222555               ................GG.AAACUCUCAGGC...................
BX640425.1/120361-120480               .............GCGGGGCAACUCUCAGGC...................
BX640445.1/160122-160016               UUGCAGCGGCGCACGGGUGAAGCUCUCAGGU...................
BX640439.1/206557-206676               .............GCGGGGCAACUCUCAGGC...................
BX640439.1/206443-206535               ................GG.AAUCGCUCAGGU...................
BX640445.1/160210-160126               ................GG.AAACUCUCAGGC...................
AL646074.1/141575-141672               .................GAAAACUCUCAGGC...................
AL646074.1/141686-141809               ACGCGUUGUGUCGCUUCCCAAUCUCUCAGGU...................
AE016917.1/68424-68339                 ................AU.AAUCGCUCAGGC...................
AE016922.1/90836-90738                 ..............GCCGGAAAAUCUCAGGU...................
AE016917.1/68334-68236                 ................GCGCAACUCUCAGGU...................
AE016922.1/90941-90851                 ................GC.AAUCGCUCAGGC...................
AL162754.2/59297-59394                 ................UUAAAUCGCUCAGGU...................
AL162754.2/59398-59550                 CAUCAUGCGGAUACGGCCGAAAAUCUCAGGU...................
BX321858.1/45114-45207                 ................GUAAAACUCUCAGGU...................
BX321858.1/45005-45113                 ................GG.AAUCGCUCAGGU...................
CR522870.1/1448610-1448703             ....................AUCUUUCAGGU...................
CR522870.1/1448704-1448793             ................GUGAACCUCUCAGGU...................
AE017311.1/207809-207719               .........UGUGGCGGUGAAACUCUCAGGU...................
AE017311.1/207890-207810               ....................AUCUUUCAGGC...................
AE015530.1/8809-8928                   .........UAAACAAAGCACUCUUUCAGGU...................
AE015530.1/8929-9047                   UGUGUUGUUAAGCGACGCGAAACGCUCAGGC...................
BX950851.1/2645129-2645034             ............CUGCGU.AAACUCUCAGGU...................
BX950851.1/2645260-2645133             ................AU.AAUCGCUCAGGC...................
U32770.1/3645-3566                     ...................AAUCUUUCAGGU...................
U32770.1/3564-3455                     ..........UCGUUUUUCAAACGCUCAGGC...................
AE017152.1/58537-58646                 ........AAAUUUAUGUGAAACGCUCAGGC...................
AE006044.1/6136-6252                   UUAAUUUUUCCGUUUUUUCAAACGCUCAGGC...................
AE006044.1/6045-6135                   ...................ACUCUUUCAGGC...................
CR543861.1/1990167-1990077             ................CGGAAACUCUCAGGC...................
CR543861.1/1990073-1989965             UGGAAAUCUAUAGCUACCGAAGCUCUCAGGU...................
CR378670.1/15794-15904                 UUAACAUGCAUGGAAAGUGAAACUCUCAGGC...................
CR378670.1/15611-15793                 UGUUCAAACACAAGACGUUAAUCUUUCAGGC..ACUGGAUUACAUACCUU
AE004221.1/2349-2255                   .......AUAUGCAGAGUGAAACUCUCAGGC...................
AE004221.1/2485-2350                   ....................AUCUUUCAGGUGCAUUAUUCUUAGCCAUAU
AE016806.1/33242-33376                 ....................AUCUUUCAGGU.GCAAUAUUCUUAUUGGUU
AE012210.1/6050-5969                   .................GUAAUCGCUCAGGC...................
AE012210.1/5968-5859                   CAGGCCAGGCCGCGUUCUUAAACUCUCAGGC...................
AE011751.1/9456-9347                   CGCGCCAGGCCGCGUUUUUAAACUCUCAGGC...................
AE011751.1/9538-9457                   .................GUAAUCGCUCAGGC...................
#=GC SS_cons                           ................>>....>>>>>.>>>...................

AE017232.1/187112-187234               ..GCCCGGCGAACGGGU..GAA.GA.CAGAGGAAGAGGA
AE017232.1/187012-187109               .................ACCCG.GA.CCGCGCGAAACAU
BX842577.1/344457-344587               ..GCCUGGCGUGCAGGU..GAA.GA.CAGAGGGAGAGGG
AE000516.2/79183-79076                 .................UUCAG.GA.CAGAGCGGGGAGG
BX842577.1/344356-344453               .................ACCCG.GA.CCGCGCGAGACUA
AE000516.2/79275-79185                 .................CCAAG.CA.CCACACCGCCGAG
AJ301559.2/6878-7012                   ..GCACGCGUCAGCGAGCACAC.GA.CAGAGGGGGAGGA
AJ301559.2/6784-6876                   .................ACACG.GA.C...GCGUGUGGG
AE016822.1/1714518-1714420             .................ACGCG.UA.CCGCAUCGGACUG
AE016822.1/1714418-1714292             .................CGGAU.GA.CAGAGGGGGAGUU
AL939108.1/255442-255325               ................UGAGAU.GA.CAGAGGGGGAGGC
AL939123.1/278145-278052               .................ACCGU.UA.CCGCGCGGGCGAG
AL939123.1/278050-277936               ................UCCGAU.GA.CAGAUGGGGAGGA
AL939108.1/255539-255444               .................UCACG.UA.CCGCACGGACGAG
D84432.1/169999-170100                 .................AAAAG.AA.CUCUUGCUCGACG
AE017005.1/149900-149799               ..........CUUGGUUACAAG.UA...GAACUGCAUGG
AE017355.1/2242861-2242742             .................AAAAG.GA.CAGAGACAAGCGA
AE017355.1/2242962-2242862             ..........CUUGUUUACAAG.UA...GAACUGCAUGG
AE017271.1/283102-282983               .................AAAAG.GA.CAGAGACAAGCGA
AL596168.1/161626-161717               .................AAAAG.GA.UGUUUACGGGACG
AL591978.1/212840-212931               .................AAAAG.GA.UGUUUACGGGACG
AE017326.1/175321-175412               .................AAAAG.GA.UGUUUACGGGACG
AE016748.1/54065-53923                 .................AAAAG.GA.UAAUACUGUAACG
AE015942.1/292344-292250               .................AAAAG.GA.CAGAGCGUAGAAG
AE007658.1/8894-8810                   .................AAAAG.GA.CAGGGGACAGAUA
AE015942.1/117166-117273               .................AAAAG.AA.UUAUACUUUGAUA
AJ276209.1/792-890                     .................AAAAG.GA.UUUUGCUUGGACA
AE015942.1/292435-292345               ..ACCAUUGUUUAUGGC..GAG.GA.CUGUUAUUGGACG
AE007658.1/8987-8895                   ....AUCUAUUUAAUUAGAGAU.GA.CCGCUAUUGGAUG
AJ312125.1/523-454                     ................U..UAG.GA.CUGUCAUCA....
AJ312125.1/453-315                     .................AAAAG.GA.CAGAGAACUGAAU
AE013002.1/8534-8441                   .................AGAAA.AA.CAGAGGAGUUGUG
AE013002.1/8645-8535                   .................GGCAG.GA.UCGCUAUCGGAUA
AE013139.1/7699-7613                   .................AAACA.GA.CGGGGGAAUAAAA
AE013139.1/7801-7700                   .................AAAAG.GA.CCGCAUUCGGACC
AE006566.1/2765-2849                   .....GUUCAGUUUUUGAACGG.GA.CUGUUUGAUGGAC
AE014954.1/5814-5899                   .................AAAAG.GA.CAGAAAAGAAAAA
AE008417.1/5102-5190                   .................AAAAG.GA.CAGAGCUAGGAUA
AE006566.1/2851-2932                   .................AAAAG.GA.CAGAAGGUAAAAU
AE010046.1/2764-2849                   .....GUUCAGUUUUUGAACGG.GA.CUGUUUGAUGGAC
AL766849.1/65640-65772                 .................AAAAG.GA.CAGAAGCUAAAAG
AL766849.1/65560-65639                 ..........GUCUUAAGACAG.GA.CUGAUUGAC....
AE006003.1/9570-9465                   ................GCCAAG.GA.CAGCGGGGGCAGA
AE005997.1/1861-1775                   .................AAAAG.GA.CCGCGCGGG....
AE006003.1/9660-9572                   .................AGAAG.GA.CCGCGCGAGACGU
AE005997.1/1774-1655                   ................CCAAGG.GA.CAGCGGGGGCGAC
BX897699.1/1435970-1435876             ..............UCU..AAG.GA.CCGUAAAAGAAGA
BX897699.1/1435871-1435783             ................U..UGU.AA.CAGAGGGGUGCAG
BX572605.1/160757-160849               .................ACAGC.GA.CAGAUGGGGCUCG
BX572605.1/160670-160756               .................AAACG.GA.CCGCGCGGC....
AE009691.1/7488-7590                   ................C..UGA.GA.CAGAGGGGCACGA
AE008071.1/8587-8502                   .................AAAAG.GACCAGCGAUGA....
AE008071.1/8501-8413                   ................GACAAG.GA.CAGAGGGGGCUCU
AL591787.1/222640-222555               .................CAAAG.GA.CC.AGCAAGGUGC
BX640425.1/120361-120480               .................AAAAG.GA.CAGAGGGGCGGAA
BX640445.1/160122-160016               .................AAAUG.GA.CAGAUGGGGUUGC
BX640439.1/206557-206676               .................AAAAG.GA.CAGAGGGGCGGAA
BX640439.1/206443-206535               ................AACCCA.UA.CCGCGACUGCAUC
BX640445.1/160210-160126               .................AAAAG.GA.CCGACCUGC....
AL646074.1/141575-141672               ..............AUC..CAG.GA.CCGGGUGGAUCGG
AL646074.1/141686-141809               ................ACCAAG.GA.CAGAGGGGCCACC
AE016917.1/68424-68339                 .................AACCG.UA.CCGCAGCGCCGUA
AE016922.1/90836-90738                 .................GCAGG.GA.CAGAGGGGUGUGG
AE016917.1/68334-68236                 ................AAAAAG.GA.CAAGGGGAGAGGC
AE016922.1/90941-90851                 .................AAAAG.GA.CUGUAUCAUCGGG
AL162754.2/59297-59394                 ..............AUC..AGG.GA.CUGCACAUUGAAA
AL162754.2/59398-59550                 .................UCAAG.GA.CAGAUAGGGUCAU
BX321858.1/45114-45207                 .................AAAAG.GA.CAGAGGGGUAAGU
BX321858.1/45005-45113                 .GUGGCCAUAAGGCUUG..AGU.AA.CUGCUUGUGAUUG
CR522870.1/1448610-1448703             .................CAAAG.GA.CUGCUAUGGGACG
CR522870.1/1448704-1448793             .................ACAAGGGA.CAGAGUGUAGCAG
AE017311.1/207809-207719               .................AAAAG.GA.CAGAGGGAGGGCC
AE017311.1/207890-207810               .................GAAAG.GA.CUGCUGUCCGACG
AE015530.1/8809-8928                   .......GCCGCAAGGC..GUG.GA.CUGUUACUGGACG
AE015530.1/8929-9047                   .................AAAAG.GA.CAGAGGAGAGGAU
BX950851.1/2645129-2645034             ................AAAGCG.GA.CAGAGGGAGUGGC
BX950851.1/2645260-2645133             ................UACCCU.AA.CUGCGAAUU....
U32770.1/3645-3566                     .................GCGAU.GG.CAGGGACUGUUAC
U32770.1/3564-3455                     .................AAAAG.GA.CAGGGGCAAAAGA
AE017152.1/58537-58646                 .................AAAAG.GA.CAGGGGAGAAAAG
AE006044.1/6136-6252                   .................AAAAG.GA.CAGGGGCAACAAG
AE006044.1/6045-6135                   ....GCUGAUUAUAAGC..AGG.GA.CUGUUACUGGACG
CR543861.1/1990167-1990077             .................AGAAG.GA.CUGUAAUAAUCGA
CR543861.1/1990073-1989965             .................ACCCU.GA.CAGAUGGGGCAAC
CR378670.1/15794-15904                 .................AAAAG.GA.CAGAGGAGAUAAG
CR378670.1/15611-15793                 UUAACAAGGUAUCCGGU..AUG.GA.CUGUUAUUGGAGG
AE004221.1/2349-2255                   .................AAAAG.GA.CAGAGGAGUGAAA
AE004221.1/2485-2350                   AUUGGCAACGAAUAAGC..GAG.GA.CUGUAGUUGGAGG
AE016806.1/33242-33376                 AUAUCAAGAGAAUAUGC..GAG.GA.CUGUAGUUGGAGG
AE012210.1/6050-5969                   ................C..CGA.UA.CC.AUCUUCAACA
AE012210.1/5968-5859                   .................AAAAG.GA.CAGAGGGGCGCGA
AE011751.1/9456-9347                   .................AAAAG.GA.CAGAGGGGCGCGA
AE011751.1/9538-9457                   ................C..CGA.UA.CC.AUCCGCAGUA
#=GC SS_cons                           ..........................>>>>>>>>.....
//

Department of Computer Science and Information Engineering, National Central University, Tao-yuan, Taiwan
Contact with site administrator:
Tzu-Hao Chang